Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of IcaR regulog to Staphylococcus aureus subsp. aureus str. JKD6008

Reference regulog properties
Source regulog: IcaR - Staphylococcaceae
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Intercellular adhesion
Effector:
Phylum: Firmicutes
Propagated regulon:
Target genome Staphylococcus aureus subsp. aureus str. JKD6008
Orthologous TF(s) SauraJK_010100002703
Regulated genes 2
Built upon 4 sites [see more]
Predicted regulatory interactions in Staphylococcus aureus subsp. aureus str. JKD6008
Locus tag Position Score Sequence
Position: -29
Score: 7.2
Sequence: ACCTAACTAACGAAAGGTAGGT
Locus tag: SauraJK_010100002698
SauraJK_010100002698 -29 7.2 ACCTAACTAACGAAAGGTAGGT
Supported by regulated orthologs from reference regulons
Ortholog gene name: icaA
Ortholog function: polysaccharide intercellular adhesin biosynthesis N-glycosyltransferase (EC 2.4.-.-)
Staphylococcus aureus subsp. aureus N315 SA2459 -29 7.2 ACCTAACTAACGAAAGGTAGGT
Staphylococcus capitis SK14 STACA0001_0088 -29 7.2 ACCTAACTAACGAAAGGTAGGT
Position: -156
Score: 7.2
Sequence: ACCTACCTTTCGTTAGTTAGGT
Locus tag: SauraJK_010100002703
SauraJK_010100002703 -156 7.2 ACCTACCTTTCGTTAGTTAGGT
Supported by regulated orthologs from reference regulons
Ortholog gene name: icaR
Ortholog function: icaADBC operon transcriptional regulator
Staphylococcus aureus subsp. aureus N315 SA2458 -156 7.2 ACCTACCTTTCGTTAGTTAGGT
Staphylococcus capitis SK14 STACA0001_0089 -159 7.2 ACCTACCTTTCGTTAGTTAGGT