Propagation of MalR regulog to Staphylococcus lugdunensis HKU09-01
| Source regulog: | MalR - Staphylococcaceae |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Maltose utilization; Maltodextrin utilization |
| Effector: | Maltose |
| Phylum: | Firmicutes |
| Propagated regulon: | |
| Target genome | Staphylococcus lugdunensis HKU09-01 |
| Orthologous TF(s) | SLGD_01405 |
| Regulated genes | 1 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -109
Score: 6.5 Sequence: CTGTGCAAACGTTTGCATAA
Locus tag: SLGD_01405
|
||||
| SLGD_01405 | -109 | 6.5 | CTGTGCAAACGTTTGCATAA | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: malR | ||||
| Ortholog function: Maltose operon transcriptional repressor MalR, LacI family | ||||
| Staphylococcus aureus subsp. aureus N315 | SA1339 | -112 | 6.9 | TTATGCAATCGTTTGCACAA |
| Staphylococcus haemolyticus JCSC1435 | SH1407 | -228 | 6.6 | TTATGCAAACGATTGCATTA |
| Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 | SSP1245 | -106 | 6.4 | TCGCGCAAACGTTTGCACAA |
| Macrococcus caseolyticus JCSC5402 | MCCL_0356 | -110 | 6.7 | TTATGCAATCGTTTGCAAAA |