Propagation of ArsR regulog to Staphylococcus lugdunensis HKU09-01

Reference regulog properties
Source regulog:	ArsR - Staphylococcaceae
Regulator type:	Transcription factor
Regulator family:	ArsR
Regulation mode:	repressor
Biological process:	Arsenic resistance
Effector:	Arsenate; Arsenite
Phylum:	Firmicutes
Propagated regulon:
Target genome	Staphylococcus lugdunensis HKU09-01
Orthologous TF(s)	SLGD_00312, SLGD_00173
Regulated genes	1

Built upon 26 sites [see more]

Predicted regulatory interactions in *Staphylococcus lugdunensis HKU09-01*
	Locus tag	Position	Score	Sequence
Position: -41 Score: 7 Sequence: TATATAGATGTTAATCTATATA Locus tag: SLGD_00173
	SLGD_00173	-41	7	TATATAGATGTTAATCTATATA
Supported by regulated orthologs from reference regulons
Ortholog gene name: arsR
Ortholog function: arsenical resistance operon repressor
Macrococcus caseolyticus JCSC5402	MCCL_1484	-62	5.6	TATATAGACACTTATCTATATA
		-46	6.8	TATATAGATGTTAATCTATGTA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --