Propagation of MntR regulog to Staphylococcus epidermidis ATCC 12228
Source regulog: | MntR - Staphylococcaceae |
Regulator type: | Transcription factor |
Regulator family: | DtxR |
Regulation mode: | repressor |
Biological process: | Manganese homeostasis |
Effector: | Manganese ion, (Mn2+) |
Phylum: | Firmicutes |
Propagated regulon: | |
Target genome | Staphylococcus epidermidis ATCC 12228 |
Orthologous TF(s) | SE0408 |
Regulated genes | 2 |

Locus tag | Position | Score | Sequence | |
---|---|---|---|---|
Position: -42
Score: 6.4 Sequence: AAATTAGGTTAACCTAAACT
Locus tag: SE0407
|
||||
SE0407 | -42 | 6.4 | AAATTAGGTTAACCTAAACT | |
Supported by regulated orthologs from reference regulons | ||||
Ortholog gene name: mntA | ||||
Ortholog function: manganese ABC transport system ATPase component MntA | ||||
Staphylococcus aureus subsp. aureus N315 | SA0589 | -42 | 6.1 | TAATTAGGTTAGCCTAAACT |
Staphylococcus capitis SK14 | STACA0001_0395 | -42 | 6.1 | AAATTAGGTTAGCCTAAACT |
Staphylococcus epidermidis ATCC 12228 | SE0407 | -42 | 6.4 | AAATTAGGTTAACCTAAACT |
Staphylococcus carnosus subsp. carnosus TM300 | Sca_0275 | -141 | 6.2 | AAATTAGGTTAGCCTAAAAA |
Staphylococcus haemolyticus JCSC1435 | SH0143 | -40 | 6.4 | AAATTAGGTTAACCTAAACT |
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 | SSP2086 | -40 | 6.2 | AAATTAGGTTAGCCTAAAAA |
Macrococcus caseolyticus JCSC5402 | MCCL_0095 | -52 | 5.9 | AGTTTAGGTTTGCCTAAAAT |
Position: -51
Score: 6.3 Sequence: TTTTTAGGTTGACCTAATAT
Locus tag: SE0803
|
||||
SE0803 | -51 | 6.3 | TTTTTAGGTTGACCTAATAT | |
Supported by regulated orthologs from reference regulons | ||||
Ortholog gene name: mntH | ||||
Ortholog function: Mn2+/Fe2+ transporter, NRAMP family | ||||
Staphylococcus aureus subsp. aureus N315 | SA0956 | -67 | 6.3 | AATTTAGGTTGACCTAAACA |
Staphylococcus capitis SK14 | STACA0001_2258 | -66 | 6.1 | TTTTTAGGTTGACCTAACTT |
Staphylococcus epidermidis ATCC 12228 | SE0803 | -51 | 6.3 | TTTTTAGGTTGACCTAATAT |
-29 | 4.6 | TATTTAGGTTAATATATTCT | ||
Staphylococcus carnosus subsp. carnosus TM300 | Sca_0731 | -76 | 6.1 | TTTTTAGGTTGACCTAACTT |
Staphylococcus haemolyticus JCSC1435 | SH1847 | -65 | 6.3 | TTATTAGGTTGACCTAAAAA |
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 | SSP1685 | -73 | 6.3 | TTTTTAGGTTGACCTAATAA |
Macrococcus caseolyticus JCSC5402 | MCCL_0368 | -52 | 5.7 | TTTTTAGGTTGCCCTAAAGA |