Propagation of MtlR regulog to Staphylococcus capitis SK14

Reference regulog properties
Source regulog:	MtlR - Staphylococcaceae
Regulator type:	Transcription factor
Regulator family:	BglG
Regulation mode:	activator
Biological process:	Mannitol utilization
Effector:	MtlA, mannitol-specific enzyme IICB PTS component; HPr, phosphocarrier protein
Phylum:	Firmicutes
Propagated regulon:
Target genome	Staphylococcus capitis SK14
Orthologous TF(s)	STACA0001_0859
Regulated genes	1

Built upon 5 sites [see more]

Predicted regulatory interactions in *Staphylococcus capitis SK14*
	Locus tag	Position	Score	Sequence
Position: -108 Score: 6.2 Sequence: TTGTCACAAATATCATGACAA Locus tag: STACA0001_0858
	STACA0001_0858	-108	6.2	TTGTCACAAATATCATGACAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: mtlF
Ortholog function: mannitol specific PTS system, IIBC component
Staphylococcus aureus subsp. aureus N315	SA1960	-104	6.5	TTGTCACATTTATTTTGACAA
Staphylococcus capitis SK14	STACA0001_0858	-108	6.2	TTGTCACAAATATCATGACAA
Staphylococcus carnosus subsp. carnosus TM300	Sca_1658	-105	5.3	ATGGCAACAATTCAGTGACAA
Staphylococcus haemolyticus JCSC1435	SH0235	-105	6.8	TTGTCACAATTACTGTGACAA
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305	SSP0728	-106	6.6	TTGTCAAAGATACTGTGACAA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --