Propagation of MalR regulog to Staphylococcus aureus subsp. aureus NCTC 8325

Reference regulog properties
Source regulog:	MalR - Staphylococcaceae
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Maltose utilization; Maltodextrin utilization
Effector:	Maltose
Phylum:	Firmicutes
Propagated regulon:
Target genome	Staphylococcus aureus subsp. aureus NCTC 8325
Orthologous TF(s)	SAOUHSC_01602
Regulated genes	1

Built upon 5 sites [see more]

Predicted regulatory interactions in *Staphylococcus aureus subsp. aureus NCTC 8325*
	Locus tag	Position	Score	Sequence
Position: -66 Score: 6.7 Sequence: TTGTGCAAACGTTTTCACAA Locus tag: SAOUHSC_00175
	SAOUHSC_00175	-66	6.7	TTGTGCAAACGTTTTCACAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: mdxK
Ortholog function: Maltose/maltodextrin transport ATP-binding protein
Staphylococcus aureus subsp. aureus N315	SA0206	-66	6.7	TTGTGCAAACGTTTTCACAA
Macrococcus caseolyticus JCSC5402	MCCL_0361	-110	6.7	TTATGCAATCGTTTGCAAAA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --