Propagation of MalR regulog to Staphylococcus aureus subsp. aureus NCTC 8325
| Source regulog: | MalR - Staphylococcaceae |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Maltose utilization; Maltodextrin utilization |
| Effector: | Maltose |
| Phylum: | Firmicutes |
| Propagated regulon: | |
| Target genome | Staphylococcus aureus subsp. aureus NCTC 8325 |
| Orthologous TF(s) | SAOUHSC_01602 |
| Regulated genes | 1 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -66
Score: 6.7 Sequence: TTGTGCAAACGTTTTCACAA
Locus tag: SAOUHSC_00175
|
||||
| SAOUHSC_00175 | -66 | 6.7 | TTGTGCAAACGTTTTCACAA | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: mdxK | ||||
| Ortholog function: Maltose/maltodextrin transport ATP-binding protein | ||||
| Staphylococcus aureus subsp. aureus N315 | SA0206 | -66 | 6.7 | TTGTGCAAACGTTTTCACAA |
| Macrococcus caseolyticus JCSC5402 | MCCL_0361 | -110 | 6.7 | TTATGCAATCGTTTGCAAAA |