Propagation of CueR2 regulog to Shewanella frigidimarina NCIMB 400
| Source regulog: | CueR2 - Shewanellaceae |
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | activator |
| Biological process: | Copper resistance |
| Effector: | Copper ion, (Cu+) |
| Phylum: | Proteobacteria/gamma |
| Propagated regulon: | |
| Target genome | Shewanella frigidimarina NCIMB 400 |
| Orthologous TF(s) | Sfri_0211 |
| Regulated genes | 1 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -101
Score: 6 Sequence: ACATGGGTGTAAGACATAGGT
Locus tag: Sfri_0211
|
||||
| Sfri_0211 | -101 | 6 | ACATGGGTGTAAGACATAGGT | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: cueR2 | ||||
| Ortholog function: Copper-responsive transcriptional regulator, MerR family | ||||
| Shewanella putrefaciens CN-32 | Sputcn32_0271 | -66 | 6.1 | AGCTGTGTGTTACACACAGAG |
| Shewanella frigidimarina NCIMB 400 | Sfri_0211 | -101 | 6 | ACATGGGTGTAAGACATAGGT |
| Shewanella loihica PV-4 | Shew_3819 | -66 | 6.8 | ACCTGTGTCTAACACACAGGT |