Propagation of CueR2 regulog to Shewanella frigidimarina NCIMB 400

Reference regulog properties
Source regulog:	CueR2 - Shewanellaceae
Regulator type:	Transcription factor
Regulator family:	MerR
Regulation mode:	activator
Biological process:	Copper resistance
Effector:	Copper ion, (Cu+)
Phylum:	Proteobacteria/gamma
Propagated regulon:
Target genome	Shewanella frigidimarina NCIMB 400
Orthologous TF(s)	Sfri_0211
Regulated genes	1

Built upon 3 sites [see more]

Predicted regulatory interactions in *Shewanella frigidimarina NCIMB 400*
	Locus tag	Position	Score	Sequence
Position: -101 Score: 6 Sequence: ACATGGGTGTAAGACATAGGT Locus tag: Sfri_0211
	Sfri_0211	-101	6	ACATGGGTGTAAGACATAGGT
Supported by regulated orthologs from reference regulons
Ortholog gene name: cueR2
Ortholog function: Copper-responsive transcriptional regulator, MerR family
Shewanella putrefaciens CN-32	Sputcn32_0271	-66	6.1	AGCTGTGTGTTACACACAGAG
Shewanella frigidimarina NCIMB 400	Sfri_0211	-101	6	ACATGGGTGTAAGACATAGGT
Shewanella loihica PV-4	Shew_3819	-66	6.8	ACCTGTGTCTAACACACAGGT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --