Propagation of BetI regulog to Shewanella frigidimarina NCIMB 400
Source regulog: | BetI - Shewanellaceae |
Regulator type: | Transcription factor |
Regulator family: | TetR |
Regulation mode: | repressor |
Biological process: | Osmotic stress response |
Effector: | Betaine |
Phylum: | Proteobacteria/gamma |
Propagated regulon: | |
Target genome | Shewanella frigidimarina NCIMB 400 |
Orthologous TF(s) | Sfri_1948 |
Regulated genes | 1 |

Locus tag | Position | Score | Sequence | |
---|---|---|---|---|
Position: -51
Score: 7.2 Sequence: TTAATTGAGCGTTCAATTAA
Locus tag: Sfri_1948
|
||||
Sfri_1948 | -51 | 7.2 | TTAATTGAGCGTTCAATTAA | |
Supported by regulated orthologs from reference regulons | ||||
Ortholog gene name: betI | ||||
Ortholog function: glycine betaine biosynthesis transcriptional regulator, TetR family | ||||
Shewanella baltica OS155 | Sbal_1323 | -63 | 7 | TGGATTGAACGTTCAATTAA |
Shewanella denitrificans OS217 | Sden_0713 | -46 | 7.5 | TTAATTGAACGTTCAATTAA |
Shewanella frigidimarina NCIMB 400 | Sfri_1948 | -51 | 7.2 | TTAATTGAGCGTTCAATTAA |
Shewanella pealeana ATCC 700345 | Spea_1009 | -97 | 7.3 | TTAATTGAACGTTCAATCAA |
Shewanella halifaxensis HAW-EB4 | Shal_1059 | -96 | 7.3 | TTAATTGAACGTTCAATCAA |
Shewanella sediminis HAW-EB3 | Ssed_1121 | -73 | 7.5 | TTAATTGAACGTTCAATTAA |
Shewanella woodyi ATCC 51908 | Swoo_1198 | -83 | 7.5 | TTAATTGAACGTTCAATTAA |