Propagation of CueR regulog to Shewanella denitrificans OS217

Reference regulog properties
Source regulog:	CueR - Shewanellaceae
Regulator type:	Transcription factor
Regulator family:	MerR
Regulation mode:	activator (repressor)
Biological process:	Copper resistance
Effector:	Copper ion, (Cu+)
Phylum:	Proteobacteria/Gamma
Propagated regulon:
Target genome	Shewanella denitrificans OS217
Orthologous TF(s)	Sden_3690
Regulated genes	1

Built upon 26 sites [see more]

Predicted regulatory interactions in *Shewanella denitrificans OS217*
	Locus tag	Position	Score	Sequence
Position: -61 Score: 5.1 Sequence: ACCTTACCATGATGGCAAGCT Locus tag: Sden_3691
	Sden_3691	-61	5.1	ACCTTACCATGATGGCAAGCT
Supported by regulated orthologs from reference regulons
Ortholog gene name: copA
Ortholog function: Copper-translocating P-type ATPase (EC 3.6.3.4)
Shewanella denitrificans OS217	Sden_3691	-61	5.1	ACCTTACCATGATGGCAAGCT
Shewanella amazonensis SB2B	Sama_1786	-67	5.5	ACCTTCCCATAATGGCAAGGT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --