Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of YybR/YdeP regulog to Bacillus cereus H3081.97

Reference regulog properties
Source regulog: YybR/YdeP - Bacillales
Regulator type: Transcription factor
Regulator family: HxlR
Regulation mode: activator
Biological process: Multidrug resistance
Effector:
Phylum: Firmicutes
Propagated regulon:
Target genome Bacillus cereus H3081.97
Orthologous TF(s) BcerH_010100006607
Regulated genes 2
Built upon 21 sites [see more]
Predicted regulatory interactions in Bacillus cereus H3081.97
Locus tag Position Score Sequence
Position: -42
Score: 6.3
Sequence: TAGTATCAAAAAAGATACTA
Locus tag: BcerH_010100006607
BcerH_010100006607 -42 6.3 TAGTATCAAAAAAGATACTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: yybR
Ortholog function: Transcriptional regulator, HxlR family
Bacillus amyloliquefaciens FZB42 RBAM_037620 -33 6 TAGTATCAAAAAAGGTACTA
Bacillus cereus ATCC 14579 BC3320 -42 6.3 TAGTATCAAAAAAGATACTA
Bacillus halodurans C-125 BH0737 -49 5.2 TAGTTACATGTAGGTTACTA
Bacillus subtilis subsp. subtilis str. 168 BSU05290 -35 6.2 TAGTATCAAAAAGTATACTA
Bacillus subtilis subsp. subtilis str. 168 BSU40540 -34 6 TAGTATCAAAAAAGGTACTA
Paenibacillus sp. JDR-2 Pjdr2_4452 -72 6 TAGTATTAAAAAGGATACTA
Position: -106
Score: 6.3
Sequence: TAGTATCTTTTTTGATACTA
Locus tag: BcerH_010100006612
BcerH_010100006612 -106 6.3 TAGTATCTTTTTTGATACTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: yfkO
Ortholog function: Oxygen-insensitive NAD(P)H nitroreductase (EC 1.-.-.-) / Dihydropteridine reductase (EC 1.5.1.34)
Bacillus cereus ATCC 14579 BC3321 -107 6.3 TAGTATCTTTTTTGATACTA