Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of SO1703 regulog to Shewanella baltica OS155

Reference regulog properties
Source regulog: SO1703 - Shewanellaceae
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Multidrug resistance
Effector:
Phylum: Proteobacteria/gamma
Propagated regulon:
Target genome Shewanella baltica OS155
Orthologous TF(s) Sbal_1521
Regulated genes 1
Built upon 11 sites [see more]
Predicted regulatory interactions in Shewanella baltica OS155
Locus tag Position Score Sequence
Position: -35
Score: 6.6
Sequence: TATTCATCAATAGATGAATT
Locus tag: Sbal_1521
Sbal_1521 -35 6.6 TATTCATCAATAGATGAATT
Supported by regulated orthologs from reference regulons
Ortholog gene name: SO1703
Ortholog function: Transcriptional regulator, TetR family
Shewanella oneidensis MR-1 SO_1703 -35 6.5 TATTCATCAGTAGATGAATT
Shewanella putrefaciens CN-32 Sputcn32_1419 -35 6.5 TATTCATCAGTAGATGAATT
Shewanella sp W3-18-1 Sputw3181_2681 -35 6.5 TATTCATCAGTAGATGAATT
Shewanella sp ANA-3 Shewana3_2751 -35 6.5 TATTCATCAGTAGATGAATT
Shewanella sp MR-4 Shewmr4_2576 -35 6.6 TATTCATCAATAGATGAATT
Shewanella sp MR-7 Shewmr7_2643 -35 6.6 TATTCATCAATAGATGAATT
Shewanella baltica OS155 Sbal_1521 -35 6.6 TATTCATCAATAGATGAATT
Shewanella denitrificans OS217 Sden_2204 -64 5.7 TATTCATCAGATGGGGAATT
Shewanella amazonensis SB2B Sama_3590 -33 5.8 TGTTCATCAAGAGAGGAATT
Shewanella loihica PV-4 Shew_3567 -23 6.3 AATTCCTCTACTGAGGAATT
Shewanella sediminis HAW-EB3 Ssed_2917 -24 5.7 AATTCTTTAACTGAGGAATA