Propagation of PnuR regulog to Shewanella baltica OS155
| Source regulog: | PnuR - Shewanellaceae |
| Regulator type: | Transcription factor |
| Regulator family: | CRP |
| Regulation mode: | activator |
| Biological process: | NAD biosynthesis |
| Effector: | |
| Phylum: | Proteobacteria/gamma |
| Propagated regulon: | |
| Target genome | Shewanella baltica OS155 |
| Orthologous TF(s) | Sbal_3793 |
| Regulated genes | 1 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -83
Score: 4.5 Sequence: AAAGGGACAAAAGTCCGTTT
Locus tag: Sbal_3795
|
||||
| Sbal_3795 | -83 | 4.5 | AAAGGGACAAAAGTCCGTTT | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: pnuC | ||||
| Ortholog function: Ribosyl nicotinamide transporter, PnuC-like | ||||
| Shewanella baltica OS155 | Sbal_3795 | -83 | 4.5 | AAAGGGACAAAAGTCCGTTT |