Propagation of ModE regulog to Shewanella baltica OS155

Reference regulog properties
Source regulog:	ModE - Shewanellaceae
Regulator type:	Transcription factor
Regulator family:	ModE
Regulation mode:	repressor
Biological process:	Molybdopterin biosynthesis; Molybdenum homeostasis
Effector:	Molybdate
Phylum:	Proteobacteria/gamma
Propagated regulon:
Target genome	Shewanella baltica OS155
Orthologous TF(s)	Sbal_3537
Regulated genes	1

Built upon 10 sites [see more]

Predicted regulatory interactions in *Shewanella baltica OS155*
	Locus tag	Position	Score	Sequence
Position: -52 Score: 6.4 Sequence: ATCGATATATAGATTGGTATATAACGAT Locus tag: Sbal_3538
	Sbal_3538	-52	6.4	ATCGATATATAGATTGGTATATAACGAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: modA2
Ortholog function: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
Shewanella oneidensis MR-1	SO_3863	-73	5.9	CTCGATATATAGATTGGTATATATCGAT
Shewanella sp ANA-3	Shewana3_0743	-52	5.9	ACCGATATATAGATTGGTATATAACGAT
Shewanella sp MR-4	Shewmr4_3195	-52	6.4	ATCGATATATAGATTGGTATATAACGAT
Shewanella sp MR-7	Shewmr7_0769	-52	6.4	ATCGATATATAGATTGGTATATAACGAT
Shewanella baltica OS155	Sbal_3538	-52	6.4	ATCGATATATAGATTGGTATATAACGAT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --