Propagation of YdfL regulog to Bacillus cereus H3081.97
| Source regulog: | YdfL - Bacillales |
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | activator |
| Biological process: | Multidrug resistance |
| Effector: | |
| Phylum: | Firmicutes |
| Propagated regulon: | |
| Target genome | Bacillus cereus H3081.97 |
| Orthologous TF(s) | BcerH_010100007397 |
| Regulated genes | 1 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -64
Score: 6.1 Sequence: GACCTTCAAGTTACTTTAAGGTT
Locus tag: BcerH_010100007402
|
||||
| BcerH_010100007402 | -64 | 6.1 | GACCTTCAAGTTACTTTAAGGTT | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: BC1615 | ||||
| Ortholog function: Na+ driven multidrug efflux pump | ||||
| Bacillus licheniformis DSM 13 | BLi02817 | -58 | 6.2 | GACCTTCAAGTAACTTGAAGGTT |
| Bacillus cereus ATCC 14579 | BC1615 | -66 | 6.3 | GACCTTCAAGTTACTTGAAGGTT |