Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of SO4468 regulog to Shewanella sp W3-18-1

Reference regulog properties
Source regulog: SO4468 - Shewanellaceae
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process:
Effector:
Phylum: Proteobacteria/gamma
Propagated regulon:
Target genome Shewanella sp W3-18-1
Orthologous TF(s) Sputw3181_0228
Regulated genes 2
Built upon 22 sites [see more]
Predicted regulatory interactions in Shewanella sp W3-18-1
Locus tag Position Score Sequence
Position: -64
Score: 5.9
Sequence: TTAGACGACTGGTCTACTAA
Locus tag: Sputw3181_0227
Sputw3181_0227 -64 5.9 TTAGACGACTGGTCTACTAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: SO4469
Ortholog function: Alcohol dehydrogenase, iron-containing
Shewanella oneidensis MR-1 SO_4469 -52 6 CTAGACGACTGGTCTACTAA
Shewanella putrefaciens CN-32 Sputcn32_0377 -64 5.9 TTAGACGACTGGTCTACTAA
Shewanella sp W3-18-1 Sputw3181_0227 -64 5.9 TTAGACGACTGGTCTACTAA
Shewanella sp ANA-3 Shewana3_0261 -52 6 CTAGACGACTGGTCTACTAA
Shewanella sp MR-4 Shewmr4_0260 -51 6 CTAGACGACTGGTCTACTAA
Shewanella sp MR-7 Shewmr7_3761 -51 6 CTAGACGACTGGTCTACTAA
Shewanella baltica OS155 Sbal_0271 -104 5.9 TTAGACGACTGGTCTACTAA
Shewanella piezotolerans WP3 swp_0256 -62 6 CTAGACGACTGGTCTACTAA
Shewanella sediminis HAW-EB3 Ssed_0286 -59 6 CTAGACGACTGGTCTACTAA
Position: -25
Score: 5.7
Sequence: CTAGACGACCGGTCTAATTT
Locus tag: Sputw3181_0228
Sputw3181_0228 -25 5.7 CTAGACGACCGGTCTAATTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: SO4468
Ortholog function: Transcriptional regulator, TetR family
Shewanella oneidensis MR-1 SO_4468 -38 5.6 CTAGACGACTGGTCTAATTT
Shewanella putrefaciens CN-32 Sputcn32_0378 -25 5.7 CTAGACGACCGGTCTAATTT
Shewanella sp W3-18-1 Sputw3181_0228 -25 5.7 CTAGACGACCGGTCTAATTT
Shewanella sp ANA-3 Shewana3_0262 -38 5.8 CTAGACGACTGGTCTAATAT
Shewanella sp MR-4 Shewmr4_0261 -38 5.6 CTAGACGACTGGTCTAATTT
Shewanella sp MR-7 Shewmr7_3760 -38 5.6 CTAGACGACTGGTCTAATTT
Shewanella baltica OS155 Sbal_0272 -37 5.6 CTAGACGACCGGTCTATTTT
Shewanella denitrificans OS217 Sden_1388 -36 5.9 CTAGACGACCGGTCTAATTG
Shewanella amazonensis SB2B Sama_0476 -37 5.6 CTAGACGACTGGTCTAATCG
Shewanella piezotolerans WP3 swp_0257 -37 5.6 CTAGACGACCGGTCTAATAC
Shewanella sediminis HAW-EB3 Ssed_0287 -36 5.5 CTAGACGACCGGTCTATTCT