Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of PnuR regulog to Shewanella sp W3-18-1

Reference regulog properties
Source regulog: PnuR - Shewanellaceae
Regulator type: Transcription factor
Regulator family: CRP
Regulation mode: activator
Biological process: NAD biosynthesis
Effector:
Phylum: Proteobacteria/gamma
Propagated regulon:
Target genome Shewanella sp W3-18-1
Orthologous TF(s) Sputw3181_0450
Regulated genes 1
Built upon 4 sites [see more]
Predicted regulatory interactions in Shewanella sp W3-18-1
Locus tag Position Score Sequence
Position: -126
Score: 5.4
Sequence: TAGGAGACAAATGTCCTCTG
Locus tag: Sputw3181_0453
Sputw3181_0453 -126 5.4 TAGGAGACAAATGTCCTCTG
Supported by regulated orthologs from reference regulons
Ortholog gene name: SO4295
Ortholog function: NAD(P)H oxidoreductase YRKL (EC 1.6.99.-)
Shewanella oneidensis MR-1 SO_4295 -127 5.4 TAGGAGACAAATGTCCTCTG
Shewanella putrefaciens CN-32 Sputcn32_3486 -126 5.4 TAGGAGACAAATGTCCTCTG
Shewanella sp W3-18-1 Sputw3181_0453 -126 5.4 TAGGAGACAAATGTCCTCTG
© 2009-2020 RegPrecise