Propagation of PnuR regulog to Shewanella oneidensis MR-1
| Source regulog: | PnuR - Shewanellaceae |
| Regulator type: | Transcription factor |
| Regulator family: | CRP |
| Regulation mode: | activator |
| Biological process: | NAD biosynthesis |
| Effector: | |
| Phylum: | Proteobacteria/gamma |
| Propagated regulon: | |
| Target genome | Shewanella oneidensis MR-1 |
| Orthologous TF(s) | SO4298 |
| Regulated genes | 1 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -127
Score: 5.4 Sequence: TAGGAGACAAATGTCCTCTG
Locus tag: SO4295
|
||||
| SO4295 | -127 | 5.4 | TAGGAGACAAATGTCCTCTG | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: SO4295 | ||||
| Ortholog function: NAD(P)H oxidoreductase YRKL (EC 1.6.99.-) | ||||
| Shewanella oneidensis MR-1 | SO_4295 | -127 | 5.4 | TAGGAGACAAATGTCCTCTG |
| Shewanella putrefaciens CN-32 | Sputcn32_3486 | -126 | 5.4 | TAGGAGACAAATGTCCTCTG |
| Shewanella sp W3-18-1 | Sputw3181_0453 | -126 | 5.4 | TAGGAGACAAATGTCCTCTG |