Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of SO4326 regulog to Shewanella woodyi ATCC 51908

Reference regulog properties
Source regulog: SO4326 - Shewanellaceae
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Multidrug resistance
Effector:
Phylum: Proteobacteria/gamma
Propagated regulon:
Target genome Shewanella woodyi ATCC 51908
Orthologous TF(s) Swoo_0467
Regulated genes 1
Built upon 8 sites [see more]
Predicted regulatory interactions in Shewanella woodyi ATCC 51908
Locus tag Position Score Sequence
Position: -44
Score: 6.9
Sequence: ATGAATGAACATTCATTCAC
Locus tag: Swoo_0467
Swoo_0467 -44 6.9 ATGAATGAACATTCATTCAC
Supported by regulated orthologs from reference regulons
Ortholog gene name: vexR
Ortholog function: putative bile resistance transcriptional regulator VexR, TetR family
Shewanella oneidensis MR-1 SO_4326 0 7.6 ATGAATGAACGTTCATTCAT
Shewanella sp ANA-3 Shewana3_0373 -42 7.6 ATGAATGAACGTTCATTCAT
Shewanella amazonensis SB2B Sama_3267 -34 7.4 ATGAATGAACGTTCATTCAC
Shewanella pealeana ATCC 700345 Spea_0359 0 7.6 ATGAATGAACGTTCATTCAT
Shewanella halifaxensis HAW-EB4 Shal_3931 15 7.6 ATGAATGAACGTTCATTCAT
Shewanella piezotolerans WP3 swp_0380 -107 7.6 ATGAATGAACGTTCATTCAT
Shewanella sediminis HAW-EB3 Ssed_4148 0 7.1 GTGAATGAACGTTCATTCAG
Shewanella woodyi ATCC 51908 Swoo_0467 -44 6.9 ATGAATGAACATTCATTCAC
© 2009-2020 RegPrecise