Propagation of SO4468 regulog to Shewanella amazonensis SB2B
| Source regulog: | SO4468 - Shewanellaceae |
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | |
| Effector: | |
| Phylum: | Proteobacteria/gamma |
| Propagated regulon: | |
| Target genome | Shewanella amazonensis SB2B |
| Orthologous TF(s) | Sama_0476 |
| Regulated genes | 2 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -37
Score: 5.6 Sequence: CTAGACGACTGGTCTAATTT
Locus tag: Sama_0475
|
||||
| Sama_0475 | -37 | 5.6 | CTAGACGACTGGTCTAATTT | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: Sden_1387 | ||||
| Ortholog function: Putative oxidoreductase YncB | ||||
| Shewanella denitrificans OS217 | Sden_1387 | -31 | 5.9 | CTAGACGACCGGTCTATTAA |
| Shewanella amazonensis SB2B | Sama_0475 | -37 | 5.6 | CTAGACGACTGGTCTAATTT |
|
Position: -37
Score: 5.6 Sequence: CTAGACGACTGGTCTAATCG
Locus tag: Sama_0476
|
||||
| Sama_0476 | -37 | 5.6 | CTAGACGACTGGTCTAATCG | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: SO4468 | ||||
| Ortholog function: Transcriptional regulator, TetR family | ||||
| Shewanella oneidensis MR-1 | SO_4468 | -38 | 5.6 | CTAGACGACTGGTCTAATTT |
| Shewanella putrefaciens CN-32 | Sputcn32_0378 | -25 | 5.7 | CTAGACGACCGGTCTAATTT |
| Shewanella sp W3-18-1 | Sputw3181_0228 | -25 | 5.7 | CTAGACGACCGGTCTAATTT |
| Shewanella sp ANA-3 | Shewana3_0262 | -38 | 5.8 | CTAGACGACTGGTCTAATAT |
| Shewanella sp MR-4 | Shewmr4_0261 | -38 | 5.6 | CTAGACGACTGGTCTAATTT |
| Shewanella sp MR-7 | Shewmr7_3760 | -38 | 5.6 | CTAGACGACTGGTCTAATTT |
| Shewanella baltica OS155 | Sbal_0272 | -37 | 5.6 | CTAGACGACCGGTCTATTTT |
| Shewanella denitrificans OS217 | Sden_1388 | -36 | 5.9 | CTAGACGACCGGTCTAATTG |
| Shewanella amazonensis SB2B | Sama_0476 | -37 | 5.6 | CTAGACGACTGGTCTAATCG |
| Shewanella piezotolerans WP3 | swp_0257 | -37 | 5.6 | CTAGACGACCGGTCTAATAC |
| Shewanella sediminis HAW-EB3 | Ssed_0287 | -36 | 5.5 | CTAGACGACCGGTCTATTCT |