Propagation of CzrA regulog to Bacillus cereus H3081.97
| Source regulog: | CzrA - Bacillales |
| Regulator type: | Transcription factor |
| Regulator family: | ArsR |
| Regulation mode: | repressor |
| Biological process: | Zinc resistance; Nickel resistance; Copper resistance; Cobalt resistance; Cadmium resistance |
| Effector: | Zinc ion, (Zn2+); Silver ion, (Ag+); Nickel ion, (Ni2+); Copper ion, (Cu2+); Cobalt ion, (Co2+); Cadmium, ion (Cd2+) |
| Phylum: | Firmicutes |
| Propagated regulon: | |
| Target genome | Bacillus cereus H3081.97 |
| Orthologous TF(s) | No orthologous TFs found |
| Regulated genes | 1 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -44
Score: 6.7 Sequence: TATATGAACAAGTATTCATATA
Locus tag: BcerH_010100010502
|
||||
| BcerH_010100010502 | -44 | 6.7 | TATATGAACAAGTATTCATATA | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: czcO | ||||
| Ortholog function: CzcD accessory protein (oxidoreductase) | ||||
| Bacillus subtilis subsp. subtilis str. 168 | BSU26640 | -116 | 7.1 | TATATGAACACATGCTCATATA |
| Bacillus amyloliquefaciens FZB42 | RBAM_005610 | -106 | 6.9 | TATATGAGCACATAATCATATA |
| Geobacillus kaustophilus HTA426 | GK0582 | -48 | 7 | CATATGAACATATGCTCATATA |
| Bacillus cereus ATCC 14579 | BC3447 | -44 | 6 | TATATGAACAAATATTCATACG |