Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of IscR regulog to Marinobacter sp. ELB17

Reference regulog properties
Source regulog: IscR - Shewanellaceae
Regulator type: Transcription factor
Regulator family: Rrf2
Regulation mode: repressor
Biological process: Iron-sulfur cluster biogenesis
Effector: Iron-sulfur cluster redox state
Phylum: Proteobacteria/gamma
Propagated regulon:
Target genome Marinobacter sp. ELB17
Orthologous TF(s) MELB17_11313
Regulated genes 3
Built upon 93 sites [see more]
Predicted regulatory interactions in Marinobacter sp. ELB17
Locus tag Position Score Sequence
Position: -66
Score: 5.7
Sequence: ATAGTTGATTGTTTTAGTCAGGAAT
Locus tag: MELB17_20316
MELB17_20316 -66 5.7 ATAGTTGATTGTTTTAGTCAGGAAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: erpA
Ortholog function: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
Shewanella oneidensis MR-1 SO_1304 -88 5.8 ATACTTGAACAAAATAGTCAGGTAA
Shewanella putrefaciens CN-32 Sputcn32_1123 -64 5.8 ATACTTGAACAAAATAGTCAGGTAA
Shewanella sp W3-18-1 Sputw3181_3041 -64 5.8 ATACTTGAACAAAATAGTCAGGTAA
Shewanella sp ANA-3 Shewana3_3067 -64 5.8 ATACTTGAACAAAATAGTCAGGTAA
Shewanella sp MR-4 Shewmr4_2889 -64 5.8 ATACTTGAACAAAATAGTCAGGTAA
Shewanella sp MR-7 Shewmr7_2971 -64 5.8 ATACTTGAACAAAATAGTCAGGTAA
Shewanella baltica OS155 Sbal_1163 -64 5.7 ATACTTGAACAAAACAGTCAGGTAA
Shewanella denitrificans OS217 Sden_2815 -62 5.8 ATACTTGAACAAAATAGTCAGGTAA
Shewanella frigidimarina NCIMB 400 Sfri_2976 -63 5.8 ATACTTGAACAAAATAGTCAGGTAA
Shewanella amazonensis SB2B Sama_0843 -64 5.8 ATACTTGAACAAAATAGTCAGGTAA
Shewanella loihica PV-4 Shew_1017 -64 5.8 TTACTTGAACAAAATAGTCAGGTAT
Shewanella pealeana ATCC 700345 Spea_0985 -64 5.7 TTACTTGAACAAAACACTCAGGTAT
Shewanella halifaxensis HAW-EB4 Shal_1036 -64 5.7 TTACTTGAACAAAACACTCAGGTAT
Shewanella piezotolerans WP3 swp_3849 -64 5.4 TTACTTGAACAAAACGGTCAGGTAT
Shewanella sediminis HAW-EB3 Ssed_1095 -64 5.5 TTACTTGAACAAAATGGTCAGGTAT
Shewanella woodyi ATCC 51908 Swoo_1203 -64 5.8 ATACTTGAACAAAATGGTCAGGTAT