Propagation of IscR regulog to Marinobacter aqueolei
Source regulog: | IscR - Shewanellaceae |
Regulator type: | Transcription factor |
Regulator family: | Rrf2 |
Regulation mode: | repressor |
Biological process: | Iron-sulfur cluster biogenesis |
Effector: | Iron-sulfur cluster redox state |
Phylum: | Proteobacteria/gamma |
Propagated regulon: | |
Target genome | Marinobacter aqueolei |
Orthologous TF(s) | Maqu_1121 |
Regulated genes | 2 |

Locus tag | Position | Score | Sequence | |
---|---|---|---|---|
Position: -82
Score: 4.2 Sequence: ATGCCCGACTATTTTACTTGGTCTT
Locus tag: Maqu_1525
|
||||
Maqu_1525 | -82 | 4.2 | ATGCCCGACTATTTTACTTGGTCTT | |
Supported by regulated orthologs from reference regulons | ||||
Ortholog gene name: nfuA | ||||
Ortholog function: NfuA Fe-S protein maturation | ||||
Shewanella oneidensis MR-1 | SO_4619 | -46 | 5 | AATTCTTACTAAAACACTCAGGTAT |
Shewanella putrefaciens CN-32 | Sputcn32_3794 | -46 | 5 | AATTCTTACTAAAACACTCAGGTAT |
Shewanella sp W3-18-1 | Sputw3181_0119 | -46 | 5 | AATTCTTACTAAAACACTCAGGTAT |
Shewanella sp ANA-3 | Shewana3_4003 | -46 | 5 | AATTCTTACTAAAACACTCAGGTAT |
Shewanella sp MR-4 | Shewmr4_3804 | -46 | 5 | AATTCTTACTAAAACACTCAGGTAT |
Shewanella sp MR-7 | Shewmr7_3880 | -46 | 5 | AATTCTTACTAAAACACTCAGGTAT |
Shewanella baltica OS155 | Sbal_0142 | -46 | 5 | AATTCTTACTAAAACACTCAGGTAT |
Shewanella denitrificans OS217 | Sden_3528 | -46 | 5.4 | GTATCTTACTAAATTACTCAGGTAT |
Shewanella frigidimarina NCIMB 400 | Sfri_0244 | -46 | 5.1 | AATTCTTACTAATTTACTCAGGTAT |
Shewanella amazonensis SB2B | Sama_3502 | -44 | 4.7 | AATTCTTAGTAATTTACTCAGGTTT |
Shewanella loihica PV-4 | Shew_0106 | -46 | 4.5 | AATTCTTACTAAATCACTCGGGTTT |
Shewanella pealeana ATCC 700345 | Spea_4010 | -47 | 4.5 | AATTCTTACTAAAACACTCAGGTTT |
Shewanella halifaxensis HAW-EB4 | Shal_0247 | -47 | 4.5 | AATTCTTACTAAAACACTCAGGTTT |
Shewanella piezotolerans WP3 | swp_4841 | -48 | 4.5 | AATTCTTACTAAAACACTCAGGTTT |
Shewanella sediminis HAW-EB3 | Ssed_0179 | -47 | 4.3 | AATCCATACTAAAACACTCAAGCAT |
Shewanella woodyi ATCC 51908 | Swoo_0159 | -46 | 4.4 | AATCCATACTAAAACACTCAAGTTT |