Propagation of SO4468 regulog to Shewanella sp MR-7
Source regulog: | SO4468 - Shewanellaceae |
Regulator type: | Transcription factor |
Regulator family: | TetR |
Regulation mode: | repressor |
Biological process: | |
Effector: | |
Phylum: | Proteobacteria/gamma |
Propagated regulon: | |
Target genome | Shewanella sp MR-7 |
Orthologous TF(s) | Shewmr7_3760 |
Regulated genes | 2 |
Locus tag | Position | Score | Sequence | |
---|---|---|---|---|
Position: -38
Score: 5.6 Sequence: CTAGACGACTGGTCTAATTT
Locus tag: Shewmr7_3760
|
||||
Shewmr7_3760 | -38 | 5.6 | CTAGACGACTGGTCTAATTT | |
Supported by regulated orthologs from reference regulons | ||||
Ortholog gene name: SO4468 | ||||
Ortholog function: Transcriptional regulator, TetR family | ||||
Shewanella oneidensis MR-1 | SO_4468 | -38 | 5.6 | CTAGACGACTGGTCTAATTT |
Shewanella putrefaciens CN-32 | Sputcn32_0378 | -25 | 5.7 | CTAGACGACCGGTCTAATTT |
Shewanella sp W3-18-1 | Sputw3181_0228 | -25 | 5.7 | CTAGACGACCGGTCTAATTT |
Shewanella sp ANA-3 | Shewana3_0262 | -38 | 5.8 | CTAGACGACTGGTCTAATAT |
Shewanella sp MR-4 | Shewmr4_0261 | -38 | 5.6 | CTAGACGACTGGTCTAATTT |
Shewanella sp MR-7 | Shewmr7_3760 | -38 | 5.6 | CTAGACGACTGGTCTAATTT |
Shewanella baltica OS155 | Sbal_0272 | -37 | 5.6 | CTAGACGACCGGTCTATTTT |
Shewanella denitrificans OS217 | Sden_1388 | -36 | 5.9 | CTAGACGACCGGTCTAATTG |
Shewanella amazonensis SB2B | Sama_0476 | -37 | 5.6 | CTAGACGACTGGTCTAATCG |
Shewanella piezotolerans WP3 | swp_0257 | -37 | 5.6 | CTAGACGACCGGTCTAATAC |
Shewanella sediminis HAW-EB3 | Ssed_0287 | -36 | 5.5 | CTAGACGACCGGTCTATTCT |
Position: -51
Score: 6 Sequence: CTAGACGACTGGTCTACTAA
Locus tag: Shewmr7_3761
|
||||
Shewmr7_3761 | -51 | 6 | CTAGACGACTGGTCTACTAA | |
Supported by regulated orthologs from reference regulons | ||||
Ortholog gene name: SO4469 | ||||
Ortholog function: Alcohol dehydrogenase, iron-containing | ||||
Shewanella oneidensis MR-1 | SO_4469 | -52 | 6 | CTAGACGACTGGTCTACTAA |
Shewanella putrefaciens CN-32 | Sputcn32_0377 | -64 | 5.9 | TTAGACGACTGGTCTACTAA |
Shewanella sp W3-18-1 | Sputw3181_0227 | -64 | 5.9 | TTAGACGACTGGTCTACTAA |
Shewanella sp ANA-3 | Shewana3_0261 | -52 | 6 | CTAGACGACTGGTCTACTAA |
Shewanella sp MR-4 | Shewmr4_0260 | -51 | 6 | CTAGACGACTGGTCTACTAA |
Shewanella sp MR-7 | Shewmr7_3761 | -51 | 6 | CTAGACGACTGGTCTACTAA |
Shewanella baltica OS155 | Sbal_0271 | -104 | 5.9 | TTAGACGACTGGTCTACTAA |
Shewanella piezotolerans WP3 | swp_0256 | -62 | 6 | CTAGACGACTGGTCTACTAA |
Shewanella sediminis HAW-EB3 | Ssed_0286 | -59 | 6 | CTAGACGACTGGTCTACTAA |