Propagation of YtrA regulog to Bacillus cereus H3081.97
| Source regulog: | YtrA - Bacillales |
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | repressor |
| Biological process: | Ramoplanin resistance |
| Effector: | Ramoplanin |
| Phylum: | Firmicutes |
| Propagated regulon: | |
| Target genome | Bacillus cereus H3081.97 |
| Orthologous TF(s) | BcerH_010100014920 |
| Regulated genes | 1 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -52
Score: 5.8 Sequence: TGTATTACTCGCAATAGTACA
Locus tag: BcerH_010100014920
|
||||
| BcerH_010100014920 | -52 | 5.8 | TGTATTACTCGCAATAGTACA | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: ytrA | ||||
| Ortholog function: Transcriptional regulator, GntR family | ||||
| Bacillus subtilis subsp. subtilis str. 168 | BSU30460 | -244 | 6.5 | TGTACTAATTGAAGTAATACA |
| Bacillus amyloliquefaciens FZB42 | RBAM_027400 | -238 | 6.7 | TGTACTACTTGATGTAATACA |
| Bacillus pumilus SAFR-032 | BPUM_2677 | -234 | 6.4 | TGTACTACATCAACTAATACA |
| Bacillus licheniformis DSM 13 | BLi03185 | -223 | 6.4 | TGTACTACATCGAGTAATACA |
| Geobacillus kaustophilus HTA426 | GK1620 | -49 | 5.9 | TGTACTATTAGTTATAGTACG |
| Bacillus cereus ATCC 14579 | BC4076 | -46 | 6.4 | TGTATTACATATAGTAGTACA |