Propagation of NagR regulog to Bacillus cereus H3081.97
| Source regulog: | NagR - Bacillales |
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | repressor |
| Biological process: | N-acetylglucosamine utilization |
| Effector: | N-acetylglucosamine-6-phosphate |
| Phylum: | Firmicutes |
| Propagated regulon: | |
| Target genome | Bacillus cereus H3081.97 |
| Orthologous TF(s) | BcerH_010100022651 |
| Regulated genes | 1 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -93
Score: 6.4 Sequence: TAGAATGTATAGACAACTAC
Locus tag: BcerH_010100022661
|
||||
| BcerH_010100022661 | -93 | 6.4 | TAGAATGTATAGACAACTAC | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: nagA | ||||
| Ortholog function: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25) | ||||
| Bacillus subtilis subsp. subtilis str. 168 | BSU35010 | -72 | 5.6 | CAGCTGGTCTAGATCACTAG |
| Bacillus amyloliquefaciens FZB42 | RBAM_032200 | -73 | 6.2 | TAACTGGTCTAGATAACTAG |
| Bacillus pumilus SAFR-032 | BPUM_3138 | -71 | 5.8 | TTACTGGTATAGACAACTAT |
| Bacillus licheniformis DSM 13 | BLi04348 | -72 | 6.1 | TTATTGGTCTAGACAACTAG |
| Geobacillus kaustophilus HTA426 | GK2277 | -63 | 5.8 | TTAGTGGTATAGACAACTAG |
| Bacillus cereus ATCC 14579 | BC4055 | -99 | 6.4 | TAGAATGTATAGACAACTAC |
| Bacillus halodurans C-125 | BH0421 | -157 | 5.2 | AAATTGGTATATACAAATTA |
| Bacillus clausii KSM-K16 | ABC1489 | -79 | 6.5 | TAATTGGTATAGACAACTAA |