Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of ModE regulog to Moritella sp. PE36

Reference regulog properties
Source regulog: ModE - Shewanellaceae
Regulator type: Transcription factor
Regulator family: ModE
Regulation mode: repressor
Biological process: Molybdopterin biosynthesis; Molybdenum homeostasis
Effector: Molybdate
Phylum: Proteobacteria/gamma
Propagated regulon:
Target genome Moritella sp. PE36
Orthologous TF(s) PE36_17140
Regulated genes 1
Built upon 10 sites [see more]
Predicted regulatory interactions in Moritella sp. PE36
Locus tag Position Score Sequence
Position: -75
Score: 6
Sequence: ATCGATATATAGCTTACTATACAGCGCT
Locus tag: PE36_17160
PE36_17160 -75 6 ATCGATATATAGCTTACTATACAGCGCT
Supported by regulated orthologs from reference regulons
Ortholog gene name: modA2
Ortholog function: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
Shewanella oneidensis MR-1 SO_3863 -73 5.9 CTCGATATATAGATTGGTATATATCGAT
Shewanella sp ANA-3 Shewana3_0743 -52 5.9 ACCGATATATAGATTGGTATATAACGAT
Shewanella sp MR-4 Shewmr4_3195 -52 6.4 ATCGATATATAGATTGGTATATAACGAT
Shewanella sp MR-7 Shewmr7_0769 -52 6.4 ATCGATATATAGATTGGTATATAACGAT
Shewanella baltica OS155 Sbal_3538 -52 6.4 ATCGATATATAGATTGGTATATAACGAT
© 2009-2020 RegPrecise