Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of Fur regulog to Psychromonas sp. CNPT3

Reference regulog properties
Source regulog: Fur - Shewanellaceae
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor (activator)
Biological process: Iron homeostasis
Effector: Iron ion, (Fe2+)
Phylum: Proteobacteria
Propagated regulon:
Target genome Psychromonas sp. CNPT3
Orthologous TF(s) PCNPT3_04167
Regulated genes 2
Built upon 505 sites [see more]
Predicted regulatory interactions in Psychromonas sp. CNPT3
Locus tag Position Score Sequence
Position: -32
Score: 5.2
Sequence: AATTGATAATCATTATTACCA
Locus tag: PCNPT3_11948
PCNPT3_11948 -32 5.2 AATTGATAATCATTATTACCA
Supported by regulated orthologs from reference regulons
Ortholog gene name: fbpA
Ortholog function: ABC iron(III) transporter, periplasmic ligand-binding subunit, FbpA
Shewanella oneidensis MR-1 SO0744 -76 5.7 AACTGATAACTATTATCATTA
Shewanella putrefaciens CN-32 Sputcn32_3227 -74 5.8 AAGTGATAACTATTATCATTA
Shewanella sp W3-18-1 Sputw3181_0714 -74 5.8 AAGTGATAACTATTATCATTA
Shewanella sp ANA-3 Shewana3_3517 -76 5.7 AACTGATAACTATTATCATTA
Shewanella sp MR-4 Shewmr4_3347 -76 5.7 AACTGATAACTATTATCATTA
Shewanella sp MR-7 Shewmr7_0606 -76 5.7 AACTGATAACTATTATCATTA
Shewanella baltica OS155 Sbal_0812 -76 5.4 AACTGATAAGCATTATCATTA
Shewanella frigidimarina NCIMB 400 Sfri_0636 -67 5.9 AATTGATAACCATTATCAATT
Shewanella amazonensis SB2B Sama_0666 -57 5.8 TAGTGATAATAATTATCATTA
Shewanella loihica PV-4 Shew_0861 -41 6.1 AATTGATAATTATTATCATTA
Shewanella pealeana ATCC 700345 Spea_0844 -60 5.8 AATTGAGAATTATTATCAGTT
Shewanella halifaxensis HAW-EB4 Shal_0897 -64 5.4 AATTGAGAATTATTATCAGTC
Shewanella piezotolerans WP3 swp_4107 -60 5.2 AATTGAGAACTATTATCAGCA
Shewanella sediminis HAW-EB3 Ssed_0945 -58 5.7 GATTGATAATAATTATCATTA
Shewanella woodyi ATCC 51908 Swoo_0996 -57 5.4 AATTGATAACTATTATCATCG
© 2009-2020 RegPrecise