Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of Fur regulog to Saccharophagus degradans 2-40

Reference regulog properties
Source regulog: Fur - Shewanellaceae
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor (activator)
Biological process: Iron homeostasis
Effector: Iron ion, (Fe2+)
Phylum: Proteobacteria
Propagated regulon:
Target genome Saccharophagus degradans 2-40
Orthologous TF(s) Sde_2736
Regulated genes 7
Built upon 505 sites [see more]
Predicted regulatory interactions in Saccharophagus degradans 2-40
Locus tag Position Score Sequence
Position: -75
Score: 4.7
Sequence: TATTGAAAAGTATTAGCAAAT
Locus tag: Sde_1739
Sde_1739 -75 4.7 TATTGAAAAGTATTAGCAAAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: yceI
Ortholog function: Protein yceI precursor
Shewanella oneidensis MR-1 SO3370 -59 4.7 TTATGATAATGAACATTATTT
Shewanella putrefaciens CN-32 Sputcn32_2702 -60 4.6 TTATGATAATGGATATTGTTT
Shewanella sp W3-18-1 Sputw3181_1309 -60 4.6 TTATGATAATGGATATTGTTT
Shewanella sp ANA-3 Shewana3_1179 -59 5 TTATGATAATGACTATTATTT
Shewanella sp MR-4 Shewmr4_1178 -59 5 TTATGATAATGACTATTATTT
Shewanella sp MR-7 Shewmr7_1249 -59 5 TTATGATAATGACTATTATTT
Shewanella baltica OS155 Sbal_3041 -61 5.3 TTATGATAATGAATATTATTT
Shewanella amazonensis SB2B Sama_0950 -38 5.4 AGATGAAAACCATTCTCGTTA
Position: -108
Score: 5.3
Sequence: CATTGATAACTCTTATCATTT
Locus tag: Sde_2437
Sde_2437 -108 5.3 CATTGATAACTCTTATCATTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: Sfri_4035
Ortholog function: Conserved hypothetical signal peptide protein, possibly porin
Shewanella baltica OS155 Sbal_2014 -93 5.4 AAATGCGAATTGTTTGCATTA
Shewanella denitrificans OS217 Sden_0638 -91 5.1 AAATACGAATAGTTTGCATTA
Shewanella frigidimarina NCIMB 400 Sfri_4035 -106 5.6 TAATGATAATGGTTTGCATTA
Shewanella amazonensis SB2B Sama_0589 -84 5.1 CAATGCGAATCGTTTGCATTT
Shewanella loihica PV-4 Shew_3120 -84 5.7 TAATGATAATAGTTTGCATTA
Shewanella pealeana ATCC 700345 Spea_0712 -82 5.6 TAATGATAACGATTTGCATTA
Shewanella piezotolerans WP3 swp_4367 -81 6 AAATGAGAATAATTTGCATTA
Shewanella sediminis HAW-EB3 Ssed_3889 -83 5.6 AAATGATAACCGTTTGCATTA
Shewanella woodyi ATCC 51908 Swoo_3788 -83 5.4 GAATGATAACAATTTGCATTA
Position: -78
Score: 5.5
Sequence: AAATGATAATGATTTGCATGT
Locus tag: Sde_2885
Sde_2885 -78 5.5 AAATGATAATGATTTGCATGT
Supported by regulated orthologs from reference regulons
Ortholog gene name: SO4423.1
Ortholog function: TonB-dependent ferric achromobactin receptor
Shewanella oneidensis MR-1 SO4423.1 -98 5.4 TAATAAAAATCGTTACCATTT
Shewanella putrefaciens CN-32 Sputcn32_0401 -97 5.6 TAACGAAAATCGTTATCATTT
Shewanella sp W3-18-1 Sputw3181_0255 -97 5.6 TAACGAAAATCGTTATCATTT
Shewanella sp ANA-3 Shewana3_0286 -98 5.5 CAATAAAAATCGTTATCATTT
Shewanella sp MR-4 Shewmr4_0286 -98 5.5 CAATAAAAATCGTTATCATTT
Shewanella sp MR-7 Shewmr7_3733 -98 5.5 CAATAAAAATCGTTATCATTT
Shewanella baltica OS155 Sbal_0298 -100 5.6 GAATAAAAATCGTTATCATTT
Shewanella frigidimarina NCIMB 400 Sfri_0392 -54 5.9 TAATGATAATGAATATCATTA
Shewanella amazonensis SB2B Sama_1394 -54 5 CATTGAGAGTAATTATCATTA
Shewanella loihica PV-4 Shew_1688 -72 4.9 ATATGATAATCTATATCATTC
Shewanella pealeana ATCC 700345 Spea_0977 -108 5.3 AAACACTAATCATTATCATTT
Shewanella piezotolerans WP3 swp_1134 -108 5.2 CAACAATAATCATTATCATTT
Shewanella sediminis HAW-EB3 Ssed_1496 -51 4.9 AATCGAGAATGGTTATCATCC
Shewanella woodyi ATCC 51908 Swoo_0587 -62 5.9 TAATGGGAATAATTATCATTT
© 2009-2020 RegPrecise