Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing metY gene

Properties
Regulog: PhrR - Vibrionales
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: repressor
Biological process: Light-dependent DNA repair
Effector: Heat shock; Adenosylcobalamin
Phylum: Proteobacteria/Gamma
Built upon 16 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Vibrio angustum S14
Position: -87
Score: 6.15881
Sequence: TATACAATAAAAAAACTTGTACA
Locus tag: VAS14_11844
Name: COG3272
Funciton: COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA
Locus tag: VAS14_11849
Name: VAS14_11849
Funciton: hypothetical protein
Locus tag: VAS14_11854
Name: COG3272
Funciton: COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA
Locus tag: VAS14_11859
Name: metY
Funciton: O-acetylhomoserine sulfhydrylase (EC 2.5.1.49) / O-succinylhomoserine sulfhydrylase (EC 2.5.1.48)
Locus tag: VAS14_11864
Name: phrR
Funciton: Transcriptional regulator, MerR family, associated with photolyase
Locus tag: VAS14_11869
Name: phr
Funciton: Deoxyribodipyrimidine photolyase (EC 4.1.99.3)
Locus tag: VAS14_11874
Name: PF07366
Funciton: Protein of unknown function DUF1486
Locus tag: VAS14_11879
Name: PF00106
Funciton: Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-)
Locus tag: VAS14_11884
Name: PF01593
Funciton: Flavin containing amine oxidoreductase
Locus tag: VAS14_11889
Name: PF07103
Funciton: Protein of unknown function DUF1365
Locus tag: VAS14_11894
Name: PF02353
Funciton: S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase
Locus tag: VAS14_11899
Name: PF11086
Funciton: Protein of unknown function DUF2878
COG3272-VAS14_11849-COG3272-metY-phrR-phr-PF07366-PF00106-PF01593-PF07103-PF02353-PF11086 -87 6.2 TATACAATAAAAAAACTTGTACA VAS14_11844