Orthologous regulated operons containing VAS14_11849 gene

Properties
Regulog:	PhrR - Vibrionales
Regulator type:	Transcription factor
Regulator family:	MerR
Regulation mode:	repressor
Biological process:	Light-dependent DNA repair
Effector:	Heat shock; Adenosylcobalamin
Phylum:	Proteobacteria/Gamma

Built upon 16 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Vibrio angustum S14
Position: -87 Score: 6.15881 Sequence: TATACAATAAAAAAACTTGTACA Locus tag: VAS14_11844 Name: COG3272 Funciton: COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA Locus tag: VAS14_11849 Name: VAS14_11849 Funciton: hypothetical protein Locus tag: VAS14_11854 Name: COG3272 Funciton: COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA Locus tag: VAS14_11859 Name: metY Funciton: O-acetylhomoserine sulfhydrylase (EC 2.5.1.49) / O-succinylhomoserine sulfhydrylase (EC 2.5.1.48) Locus tag: VAS14_11864 Name: phrR Funciton: Transcriptional regulator, MerR family, associated with photolyase Locus tag: VAS14_11869 Name: phr Funciton: Deoxyribodipyrimidine photolyase (EC 4.1.99.3) Locus tag: VAS14_11874 Name: PF07366 Funciton: Protein of unknown function DUF1486 Locus tag: VAS14_11879 Name: PF00106 Funciton: Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-) Locus tag: VAS14_11884 Name: PF01593 Funciton: Flavin containing amine oxidoreductase Locus tag: VAS14_11889 Name: PF07103 Funciton: Protein of unknown function DUF1365 Locus tag: VAS14_11894 Name: PF02353 Funciton: S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase Locus tag: VAS14_11899 Name: PF11086 Funciton: Protein of unknown function DUF2878
COG3272-VAS14_11849-COG3272-metY-phrR-phr-PF07366-PF00106-PF01593-PF07103-PF02353-PF11086	-87	6.2	TATACAATAAAAAAACTTGTACA	VAS14_11844