Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing BDP_0113 gene

Properties
Regulog: ScrR - Bifidobacteriaceae
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode:
Biological process: Sucrose utilization
Effector: Sucrose
Phylum: Actinobacteria
Built upon 23 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Bifidobacterium dentium Bd1
Position: -147
Score: 6.25823
Sequence: TTATCGAACCGGTTTGACAG
Locus tag: BDP_0112
Name: null
Funciton: sugar ABC uptake system, solute-binding protein
Locus tag: BDP_0113
Name: null
Funciton: sugar ABC transport system, permease component
Locus tag: BDP_0114
Name: null
Funciton: sugar ABC uptake system, permease component
BDP_0112-BDP_0113-BDP_0114 -147 6.3 TTATCGAACCGGTTTGACAG BDP_0112