Orthologous regulated operons containing COG0642 gene

Properties
Regulog:	FnrN/FixK/AadR - Rhizobiales
Regulator type:	Transcription factor
Regulator family:	CRP
Regulation mode:	repressor (activator)
Biological process:	Oxidative stress response; Nitrogen fixation
Effector:	Oxygen
Phylum:	Proteobacteria/Alpha

Built upon 192 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Rhodopseudomonas palustris CGA009
Position: -119 Score: 4.22309 Sequence: CTCTTGATCTTGCGCAAAAC Locus tag: RPA3015 Name: phyB1 Funciton: Phytochrome, two-component sensor histidine kinase (EC 2.7.3.-); Cyanobacterial phytochrome B Locus tag: RPA3016 Name: phyB2 Funciton: Phytochrome, two-component sensor histidine kinase (EC 2.7.3.-); Cyanobacterial phytochrome B Locus tag: RPA3017 Name: rphyB Funciton: Two-component system response regulator Locus tag: RPA3018 Name: COG0642 Funciton: Hypothetical protein
phyB1-phyB2-rphyB-COG0642	-119	4.2	CTCTTGATCTTGCGCAAAAC	RPA3015

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --