Orthologous regulated operons containing ctaX gene

Properties
Regulog:	FnrN/FixK/AadR - Rhizobiales
Regulator type:	Transcription factor
Regulator family:	CRP
Regulation mode:	repressor (activator)
Biological process:	Oxidative stress response; Nitrogen fixation
Effector:	Oxygen
Phylum:	Proteobacteria/Alpha

Built upon 192 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Agrobacterium tumefaciens str. C58 (Cereon)
Position: -209 Score: 3.84627 Sequence: GCCTTTATGAAAAGCAAGCG Locus tag: Atu0769 Name: ctaB Funciton: Heme O synthase, protoheme IX farnesyltransferase (EC 2.5.1.-) COX10-CtaB Locus tag: Atu8013 Name: ctaX Funciton: Hypothetical protein in cta gene cluster Locus tag: Atu0770 Name: ctaG Funciton: Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1 Locus tag: Atu0771 Name: ctaE Funciton: Cytochrome c oxidase polypeptide III (EC 1.9.3.1)
ctaB-ctaX-ctaG-ctaE	-209	3.8	GCCTTTATGAAAAGCAAGCG	Atu0769
Bradyrhizobium sp. BTAi1
Position: -181 Score: 4.24938 Sequence: GCATTGCGATAGATCAAGAA Locus tag: BBta_0828 Name: ctaC Funciton: Cytochrome c oxidase polypeptide II (EC 1.9.3.1) Locus tag: BBta_0829 Name: ctaD Funciton: Cytochrome c oxidase polypeptide I (EC 1.9.3.1) Locus tag: BBta_0830 Name: ctaB Funciton: Heme O synthase, protoheme IX farnesyltransferase (EC 2.5.1.-) COX10-CtaB Locus tag: BBta_0831 Name: ctaX Funciton: Hypothetical protein in cta gene cluster Locus tag: BBta_0832 Name: ctaG Funciton: Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1 Locus tag: BBta_0833 Name: ctaE Funciton: Cytochrome c oxidase polypeptide III (EC 1.9.3.1)
ctaC-ctaD-ctaB-ctaX-ctaG-ctaE	-181	4.2	GCATTGCGATAGATCAAGAA	BBta_0828
Nitrobacter winogradskyi Nb-255
Position: -196 Score: 4.47443 Sequence: TGTTTGATACAGCGCAAAGA Locus tag: Nwi_0761 Name: ctaC Funciton: Cytochrome c oxidase polypeptide II (EC 1.9.3.1) Locus tag: Nwi_0762 Name: ctaD Funciton: Cytochrome c oxidase polypeptide I (EC 1.9.3.1) Locus tag: Nwi_0763 Name: ctaB Funciton: Heme O synthase, protoheme IX farnesyltransferase (EC 2.5.1.-) COX10-CtaB Locus tag: Nwi_0764 Name: ctaX Funciton: Hypothetical protein in cta gene cluster Locus tag: Nwi_0765 Name: ctaG Funciton: Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1 Locus tag: Nwi_0766 Name: ctaE Funciton: Cytochrome c oxidase polypeptide III (EC 1.9.3.1)
ctaC-ctaD-ctaB-ctaX-ctaG-ctaE	-196	4.5	TGTTTGATACAGCGCAAAGA	Nwi_0761
Rhizobium sp. NGR234
Position: -38 Score: 5.46676 Sequence: GGTTTGATCCTGATCAAGCG Locus tag: NGR_c05230 Name: ctaC Funciton: Cytochrome c oxidase polypeptide II (EC 1.9.3.1) Locus tag: NGR_c05240 Name: ctaD Funciton: Cytochrome c oxidase polypeptide I (EC 1.9.3.1) Locus tag: NGR_c05250 Name: ctaB Funciton: Heme O synthase, protoheme IX farnesyltransferase (EC 2.5.1.-) COX10-CtaB Locus tag: NGR_c05260 Name: ctaX Funciton: Hypothetical protein in cta gene cluster Locus tag: NGR_c05270 Name: ctaG Funciton: Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1 Locus tag: NGR_c05280 Name: ctaE Funciton: Cytochrome c oxidase polypeptide III (EC 1.9.3.1)
ctaC-ctaD-ctaB-ctaX-ctaG-ctaE	-38	5.5	GGTTTGATCCTGATCAAGCG	NGR_c05230
Sinorhizobium meliloti 1021
Position: -38 Score: 5.46676 Sequence: GGTTTGATCCTGATCAAGCG Locus tag: SMc00009 Name: ctaC Funciton: Cytochrome c oxidase polypeptide II (EC 1.9.3.1) Locus tag: SMc00010 Name: ctaD Funciton: Cytochrome c oxidase polypeptide I (EC 1.9.3.1) Locus tag: SMc00450 Name: ctaB Funciton: Heme O synthase, protoheme IX farnesyltransferase (EC 2.5.1.-) COX10-CtaB Locus tag: SMc00130 Name: ctaX Funciton: Hypothetical protein in cta gene cluster Locus tag: SMc00012 Name: ctaG Funciton: Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1 Locus tag: SMc00013 Name: ctaE Funciton: Cytochrome c oxidase polypeptide III (EC 1.9.3.1)
ctaC-ctaD-ctaB-ctaX-ctaG-ctaE	-38	5.5	GGTTTGATCCTGATCAAGCG	SMc00009