Orthologous regulated operons containing fixLf gene

Properties
Regulog:	FnrN/FixK/AadR - Rhizobiales
Regulator type:	Transcription factor
Regulator family:	CRP
Regulation mode:	repressor (activator)
Biological process:	Oxidative stress response; Nitrogen fixation
Effector:	Oxygen
Phylum:	Proteobacteria/Alpha

Built upon 192 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Rhizobium etli CFN 42
Position: -152 Score: 5.21759 Sequence: TCCTTGATCTACATCAACAA Locus tag: RHE_PF00508 Name: fixKf Funciton: Nitrogen fixation and oxygen response transcriptional regulator FixKf, Crp family Locus tag: RHE_PF00509 Name: fixLf Funciton: Two-component oxygen-sensor histidine kinase FixLf
fixKf-fixLf	-152	5.2	TCCTTGATCTACATCAACAA	RHE_PF00508
Rhizobium leguminosarum bv. viciae 3841
Position: -121 Score: 5.21759 Sequence: TCCTTGATCTACATCAACAA Locus tag: pRL90019 Name: fixKf Funciton: Nitrogen fixation and oxygen response transcriptional regulator FixKf, Crp family Locus tag: pRL90020 Name: fixLf Funciton: Two-component oxygen-sensor histidine kinase FixLf
fixKf-fixLf	-121	5.2	TCCTTGATCTACATCAACAA	pRL90019

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --