Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing napC gene

Properties
Regulog: FnrN/FixK/AadR - Rhizobiales
Regulator type: Transcription factor
Regulator family: CRP
Regulation mode: repressor (activator)
Biological process: Oxidative stress response; Nitrogen fixation
Effector: Oxygen
Phylum: Proteobacteria/Alpha
Built upon 192 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Bradyrhizobium japonicum USDA 110
Position: -104
Score: 5.48817
Sequence: GGATTGATCCAGATCAACGC
Locus tag: bsr7036
Name: napE
Funciton: Periplasmic nitrate reductase component NapE
Locus tag: blr7037
Name: napD
Funciton: Periplasmic nitrate reductase component NapD
Locus tag: blr7038
Name: napA
Funciton: Periplasmic nitrate reductase precursor (EC 1.7.99.4)
Locus tag: blr7039
Name: napB
Funciton: Nitrate reductase cytochrome c550-type subunit
Locus tag: blr7040
Name: napC
Funciton: Cytochrome c-type protein NapC
napE-napD-napA-napB-napC -104 5.5 GGATTGATCCAGATCAACGC bsr7036
Bradyrhizobium sp. BTAi1
Position: -103
Score: 5.19286
Sequence: GCCTTGATCCACGTCAACGC
Locus tag: BBta_1864
Name: napE
Funciton: Periplasmic nitrate reductase component NapE
Locus tag: BBta_1863
Name: napD
Funciton: Periplasmic nitrate reductase component NapD
Locus tag: BBta_1862
Name: napA
Funciton: Periplasmic nitrate reductase precursor (EC 1.7.99.4)
Locus tag: BBta_1861
Name: napB
Funciton: Nitrate reductase cytochrome c550-type subunit
Locus tag: BBta_1860
Name: napC
Funciton: Cytochrome c-type protein NapC
napE-napD-napA-napB-napC -103 5.2 GCCTTGATCCACGTCAACGC BBta_1864
Rhizobium sp. NGR234
Position: -130
Score: 4.73977
Sequence: TAATTGACGAAAATCAATTT
Locus tag: NGR_c09990
Name: napE
Funciton: Periplasmic nitrate reductase component NapE
Locus tag: NGR_c10000
Name: napF
Funciton: Periplasmic nitrate reductase, ferredoxin-type protein NapF
Locus tag: NGR_c10010
Name: napD
Funciton: Periplasmic nitrate reductase component NapD
Locus tag: NGR_c10020
Name: napA
Funciton: Periplasmic nitrate reductase precursor (EC 1.7.99.4)
Locus tag: NGR_c10030
Name: napB
Funciton: Nitrate reductase cytochrome c550-type subunit
Locus tag: NGR_c10040
Name: napC
Funciton: Cytochrome c-type protein NapC
napE-napF-napD-napA-napB-napC -130 4.7 TAATTGACGAAAATCAATTT NGR_c09990
Sinorhizobium meliloti 1021
Position: -131
Score: 4.73977
Sequence: TAATTGACGGAAATCAATTT
Locus tag: SMa1241
Name: napE
Funciton: Periplasmic nitrate reductase component NapE
Locus tag: SMa1240
Name: napF
Funciton: Periplasmic nitrate reductase, ferredoxin-type protein NapF
Locus tag: SMa1239
Name: napD
Funciton: Periplasmic nitrate reductase component NapD
Locus tag: SMa1236
Name: napA
Funciton: Periplasmic nitrate reductase precursor (EC 1.7.99.4)
Locus tag: SMa1233
Name: napB
Funciton: Nitrate reductase cytochrome c550-type subunit
Locus tag: SMa1232
Name: napC
Funciton: Cytochrome c-type protein NapC
napE-napF-napD-napA-napB-napC -131 4.7 TAATTGACGGAAATCAATTT SMa1241