Orthologous regulated operons containing bsr3073 gene

Properties
Regulog:	FnrN/FixK/AadR - Rhizobiales
Regulator type:	Transcription factor
Regulator family:	CRP
Regulation mode:	repressor (activator)
Biological process:	Oxidative stress response; Nitrogen fixation
Effector:	Oxygen
Phylum:	Proteobacteria/Alpha

Built upon 192 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Bradyrhizobium japonicum USDA 110
Position: -104 Score: 5.1644 Sequence: TCATTGACGCGGATCAATTG Position: -41 Score: 4.51609 Sequence: GATTTGTCCGGGATCAATGA Locus tag: bsr3073 Name: bsr3073 Funciton: Conserved hypothetical protein
bsr3073	-104	5.2	TCATTGACGCGGATCAATTG	bsr3073
	-41	4.5	GATTTGTCCGGGATCAATGA
Bradyrhizobium sp. BTAi1
Position: -90 Score: 4.881 Sequence: CGGTTGTTCCAGATCAATGA Locus tag: BBta_3726 Name: bsr3073 Funciton: Conserved hypothetical protein
bsr3073	-90	4.9	CGGTTGTTCCAGATCAATGA	BBta_3726
Rhodopseudomonas palustris CGA009
Position: -58 Score: 5.72616 Sequence: CGTTTGATCCAGATCAAACT Locus tag: RPA1014 Name: bsr3073 Funciton: Conserved hypothetical protein
bsr3073	-58	5.7	CGTTTGATCCAGATCAAACT	RPA1014
Xanthobacter autotrophicus Py2
Position: -72 Score: 4.31271 Sequence: CAGTTGATCGTTGTCAAAAG Locus tag: Xaut_3275 Name: bsr3073 Funciton: Conserved hypothetical protein
bsr3073	-72	4.3	CAGTTGATCGTTGTCAAAAG	Xaut_3275

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --