Orthologous regulated operons containing COG5473 gene

Properties
Regulog:	FnrN/FixK/AadR - Rhizobiales
Regulator type:	Transcription factor
Regulator family:	CRP
Regulation mode:	repressor (activator)
Biological process:	Oxidative stress response; Nitrogen fixation
Effector:	Oxygen
Phylum:	Proteobacteria/Alpha

Built upon 192 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Mesorhizobium sp. BNC1
Position: -90 Score: 5.14974 Sequence: GATTTGATCCAGAGCAAAGT Locus tag: Meso_2250 Name: ccoN Funciton: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1) Locus tag: Meso_2251 Name: ccoO Funciton: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1) Locus tag: Meso_2252 Name: ccoQ Funciton: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1) Locus tag: Meso_2253 Name: ccoP Funciton: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1) Locus tag: Meso_2254 Name: COG5473 Funciton: Predicted integral membrane protein Locus tag: Meso_2255 Name: ccoI Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4) Locus tag: Meso_2256 Name: ccoS Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
ccoN-ccoO-ccoQ-ccoP-COG5473-ccoI-ccoS	-90	5.1	GATTTGATCCAGAGCAAAGT	Meso_2250

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --