Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing pep4 gene

Properties
Regulog: TyrR - Shewanellaceae
Regulator type: Transcription factor
Regulator family: TyrR
Regulation mode: activator
Biological process: Amino acid utilization
Effector: Tyrosine; Phenylalanine
Phylum: Proteobacteria/gamma
Built upon 312 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Shewanella amazonensis SB2B
Position: -326
Score: 4.79201
Sequence: GTGTAACTACATATTTACAA
Locus tag: Sama_2026
Name: omp1
Funciton: TonB-dependent receptor
Locus tag: Sama_2025
Name: pep4
Funciton: prolyl oligopeptidase family protein
omp1-pep4 -326 4.8 GTGTAACTACATATTTACAA Sama_2026