Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing Shew_3566 gene

Properties
Regulog: SO1703 - Shewanellaceae
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Multidrug resistance
Effector:
Phylum: Proteobacteria/gamma
Built upon 11 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Shewanella denitrificans OS217
Position: -64
Score: 5.74714
Sequence: TATTCATCAGATGGGGAATT
Locus tag: Sden_2204
Name: SO1703
Funciton: Transcriptional regulator, TetR family
Locus tag: Sden_2205
Name: Shew_3566
Funciton: efflux transporter, RND family, MFP subunit
Locus tag: Sden_2206
Name: Sden_2206
Funciton: Acriflavin resistance transporter, membrane protein
SO1703-Shew_3566-Sden_2206 -64 5.7 TATTCATCAGATGGGGAATT Sden_2204
Shewanella loihica PV-4
Position: -23
Score: 6.29599
Sequence: AATTCCTCTACTGAGGAATT
Locus tag: Shew_3567
Name: SO1703
Funciton: Transcriptional regulator, TetR family
Locus tag: Shew_3566
Name: Shew_3566
Funciton: efflux transporter, RND family, MFP subunit
Locus tag: Shew_3565
Name: Sden_2206
Funciton: Acriflavin resistance transporter, membrane protein
SO1703-Shew_3566-Sden_2206 -23 6.3 AATTCCTCTACTGAGGAATT Shew_3567
Shewanella sediminis HAW-EB3
Position: -24
Score: 5.73009
Sequence: AATTCTTTAACTGAGGAATA
Locus tag: Ssed_2917
Name: SO1703
Funciton: Transcriptional regulator, TetR family
Locus tag: Ssed_2916
Name: Shew_3566
Funciton: efflux transporter, RND family, MFP subunit
Locus tag: Ssed_2915
Name: Sden_2206
Funciton: Acriflavin resistance transporter, membrane protein
SO1703-Shew_3566-Sden_2206 -24 5.7 AATTCTTTAACTGAGGAATA Ssed_2917
© 2009-2020 RegPrecise