Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing fdoI gene

Properties
Regulog: ModE3 - Alcaligenaceae
Regulator type: Transcription factor
Regulator family: ModE
Regulation mode:
Biological process: Tungsten homeostasis
Effector: Tungsten
Phylum: Proteobacteria/Beta
Built upon 5 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Bordetella petrii DSM 12804
Position: -2
Score: 6.1879
Sequence: GTATGCAAAGCATTTCATAT
Locus tag: Bpet4663
Name: fdoX
Funciton: Putative subunit of formate dehydrogenase
Locus tag: Bpet4662
Name: fdoG
Funciton: Formate dehydrogenase-O, major subunit (EC 1.2.1.2)
Locus tag: Bpet4661
Name: fdoH
Funciton: Formate dehydrogenase-O, iron-sulfur subunit (EC 1.2.1.2)
Locus tag: Bpet4660
Name: fdoY
Funciton: Putative subunit of formate dehydrogenase
Locus tag: Bpet4659
Name: fdoI
Funciton: Formate dehydrogenase-O, gamma subunit (EC 1.2.1.2)
Locus tag: Bpet4658
Name: fdoZ
Funciton: Putative subunit of formate dehydrogenase
Locus tag: Bpet4657
Name: fdhD
Funciton: Formate dehydrogenase chain D (EC 1.2.1.2)
fdoX-fdoG-fdoH-fdoY-fdoI-fdoZ-fdhD -2 6.2 GTATGCAAAGCATTTCATAT Bpet4663