Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing tupB gene

Properties
Regulog: ModE3 - Alcaligenaceae
Regulator type: Transcription factor
Regulator family: ModE
Regulation mode:
Biological process: Tungsten homeostasis
Effector: Tungsten
Phylum: Proteobacteria/Beta
Built upon 5 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Bordetella bronchiseptica RB50
Position: -81
Score: 6.06855
Sequence: CTATGCAATTCGTTTCATAT
Locus tag: BB2127
Name: tupA
Funciton: Tungstate ABC-type transporter, permease protein
Locus tag: BB2128
Name: tupC
Funciton: Tungstate ABC-type transporter, ATP-binding protein
Locus tag: BB2129
Name: tupB
Funciton: Tungstate ABC-type transporter, substrate-binding protein
tupA-tupC-tupB -81 6.1 CTATGCAATTCGTTTCATAT BB2127
Bordetella petrii DSM 12804
Position: -74
Score: 6.07182
Sequence: CTATGCAAAGTTATTCATAT
Locus tag: Bpet4655
Name: tupA
Funciton: Tungstate ABC-type transporter, permease protein
Locus tag: Bpet4654
Name: tupC
Funciton: Tungstate ABC-type transporter, ATP-binding protein
Locus tag: Bpet4653
Name: tupB
Funciton: Tungstate ABC-type transporter, substrate-binding protein
tupA-tupC-tupB -74 6.1 CTATGCAAAGTTATTCATAT Bpet4655