Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing RPA0152 gene

Properties
Regulog: ModE - Rhizobiales
Regulator type: Transcription factor
Regulator family: ModE
Regulation mode: repressor (activator)
Biological process: Molybdopterin biosynthesis
Effector: Molybdate
Phylum: Proteobacteria/Alpha
Built upon 2 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Rhodopseudomonas palustris CGA009
Position: -79
Score: 5.19079
Sequence: TTGTTTACTCAGATTACATAT
Locus tag: RPA0152
Name: RPA0152
Funciton: Hypothetical protein
Locus tag: RPA0151
Name: RPA0151
Funciton: Putative ABC transporter, substrate-binding protein
Locus tag: RPA0150
Name: RPA0150
Funciton: Putative ABC transporter, permease protein
Locus tag: RPA0149
Name: RPA0149
Funciton: Putative ABC transporter, ATP-binding protein
Locus tag: RPA0148
Name: modC2
Funciton: ABC-type molybdate transport system, ATP-binding protein
Locus tag: RPA0147
Name: modE
Funciton: Molybdate-responsive transcriptional regulator ModE
RPA0152-RPA0151-RPA0150-RPA0149-modC2-modE -79 5.2 TTGTTTACTCAGATTACATAT RPA0152