Orthologous regulated operons containing moaA gene

Properties
Regulog:	ModE - Chlorobiales
Regulator type:	Transcription factor
Regulator family:	ModE
Regulation mode:	repressor (activator)
Biological process:	Molybdopterin biosynthesis
Effector:	Molybdate
Phylum:	Chlorobi

Built upon 25 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Chlorobium limicola DSM 245
Position: -79 Score: 6.45903 Sequence: TACCGTTATACCTTTTATTATATAACGAAT Locus tag: Clim_0676 Name: omp_mod Funciton: Predicted molybdenum transport TonB-dependent receptor Locus tag: Clim_0675 Name: modA Funciton: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1) Locus tag: Clim_0674 Name: modB Funciton: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1) Locus tag: Clim_0673 Name: modE Funciton: Molybdate-responsive transcriptional regulator ModE Locus tag: Clim_0672 Name: moaA Funciton: Molybdenum cofactor biosynthesis protein MoaA
omp_mod-modA-modB-modE-moaA	-79	6.5	TACCGTTATACCTTTTATTATATAACGAAT	Clim_0676
Pelodictyon luteolum DSM 273
Position: -156 Score: 6.09545 Sequence: TTTCGTTATATTCACACTTATATAACGAAT Locus tag: Plut_1540 Name: omp_mod Funciton: Predicted molybdenum transport TonB-dependent receptor Locus tag: Plut_1541 Name: modA Funciton: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1) Locus tag: Plut_1542 Name: modB Funciton: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1) Locus tag: Plut_1543 Name: modE Funciton: Molybdate-responsive transcriptional regulator ModE Locus tag: Plut_1544 Name: moaA Funciton: Molybdenum cofactor biosynthesis protein MoaA
omp_mod-modA-modB-modE-moaA	-156	6.1	TTTCGTTATATTCACACTTATATAACGAAT	Plut_1540
Prosthecochloris vibrioformis DSM 265
Position: -47 Score: 4.8241 Sequence: CACCGTTATCACCTGAACAACACAACGAAA Locus tag: Cvib_1353 Name: omp_mod Funciton: Predicted molybdenum transport TonB-dependent receptor Locus tag: Cvib_1354 Name: modE Funciton: Molybdate-responsive transcriptional regulator ModE Locus tag: Cvib_1355 Name: moaA Funciton: Molybdenum cofactor biosynthesis protein MoaA
omp_mod-modE-moaA	-47	4.8	CACCGTTATCACCTGAACAACACAACGAAA	Cvib_1353