Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing yhcI2 gene

Properties
Regulog: YhcF - Lactobacillaceae
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode:
Biological process: Multidrug resistance; Multidrug efflux
Effector:
Phylum: Firmicutes
Built upon 14 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Lactobacillus acidophilus NCFM
Position: -43
Score: 6.56192
Sequence: ACTGTAATAGATAAATAATACAGT
Locus tag: LBA1189
Name: yhcF
Funciton: Transcriptional regulator, GntR family
Locus tag: LBA1188
Name: yhcG
Funciton: ABC-type multidrug transport system, ATPase component
Locus tag: LBA1187
Name: yhcI
Funciton: ABC-type multidrug transport system, permease component
Locus tag: LBA1186
Name: yhcI2
Funciton: ABC-type multidrug transport system, permease component
Locus tag: LBA1184
Name: yhcI3
Funciton: ABC-type multidrug transport system, permease component
yhcF-yhcG-yhcI-yhcI2-yhcI3 -43 6.6 ACTGTAATAGATAAATAATACAGT LBA1189
Lactobacillus helveticus DPC 4571
Position: -44
Score: 5.54546
Sequence: AGTGTAATAGACATGTAATACAGC
Locus tag: lhv_1290
Name: yhcF
Funciton: Transcriptional regulator, GntR family
Locus tag: lhv_1289
Name: yhcG
Funciton: ABC-type multidrug transport system, ATPase component
Locus tag: lhv_1288
Name: yhcI
Funciton: ABC-type multidrug transport system, permease component
Locus tag: lhv_1287
Name: yhcI2
Funciton: ABC-type multidrug transport system, permease component
Locus tag: lhv_1286
Name: yhcI3
Funciton: ABC-type multidrug transport system, permease component
yhcF-yhcG-yhcI-yhcI2-yhcI3 -44 5.5 AGTGTAATAGACATGTAATACAGC lhv_1290
Lactobacillus johnsonii NCC 533
Position: -42
Score: 6.35666
Sequence: AGTGTAATAGATAAACCGTACACT
Locus tag: LJ1302
Name: yhcF
Funciton: Transcriptional regulator, GntR family
Locus tag: LJ1301
Name: yhcG
Funciton: ABC-type multidrug transport system, ATPase component
Locus tag: LJ1300
Name: yhcI
Funciton: ABC-type multidrug transport system, permease component
Locus tag: LJ1299
Name: yhcI2
Funciton: ABC-type multidrug transport system, permease component
yhcF-yhcG-yhcI-yhcI2 -42 6.4 AGTGTAATAGATAAACCGTACACT LJ1302