Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing Sden_0935 gene

Properties
Regulog: AzrR - Shewanellaceae
Regulator type: Transcription factor
Regulator family: [Other]
Regulation mode: repressor
Biological process: Superoxide stress response
Effector: Paraquat
Phylum: Proteobacteria/gamma
Built upon 34 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Shewanella amazonensis SB2B
Position: -77
Score: 6.65198
Sequence: CTTTACATAATTAAGTAAAG
Locus tag: Sama_2787
Name: azr
Funciton: NADPH-dependent FMN reductase
Locus tag: Sama_2788
Name: Sden_0935
Funciton: Glyoxalase/dioxygenase superfamily protein
Locus tag: Sama_2789
Name: SO3586
Funciton: Glyoxalase family protein
azr-Sden_0935-SO3586 -77 6.7 CTTTACATAATTAAGTAAAG Sama_2787
Shewanella sediminis HAW-EB3
Position: -64
Score: 6.31833
Sequence: CTTTACAACATTTAGTAAAG
Locus tag: Ssed_0994
Name: azr
Funciton: NADPH-dependent FMN reductase
Locus tag: Ssed_0993
Name: Sden_0935
Funciton: Glyoxalase/dioxygenase superfamily protein
Locus tag: Ssed_0992
Name: SO3586
Funciton: Glyoxalase family protein
azr-Sden_0935-SO3586 -64 6.3 CTTTACAACATTTAGTAAAG Ssed_0994
Shewanella woodyi ATCC 51908
Position: -63
Score: 5.91111
Sequence: CTTTACATTACTTAGTAAAG
Locus tag: Swoo_1047
Name: azr
Funciton: NADPH-dependent FMN reductase
Locus tag: Swoo_1046
Name: Sden_0935
Funciton: Glyoxalase/dioxygenase superfamily protein
Locus tag: Swoo_1045
Name: SO3586
Funciton: Glyoxalase family protein
azr-Sden_0935-SO3586 -63 5.9 CTTTACATTACTTAGTAAAG Swoo_1047