Orthologous regulated operons containing yhcI gene

Properties
Regulog:	YhcF - Listeriaceae
Regulator type:	Transcription factor
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Multidrug efflux; Multidrug resistance
Effector:
Phylum:	Firmicutes

Built upon 4 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Listeria innocua Clip11262
Position: -49 Score: 6.82514 Sequence: AGTGTACTATTTACTTAATACACT Locus tag: lin1836 Name: yhcF Funciton: Transcriptional regulator, GntR family Locus tag: lin1835 Name: yhcG Funciton: ABC-type multidrug transport system, ATPase component Locus tag: lin1834 Name: yhcI Funciton: ABC-type multidrug transport system, permease component
yhcF-yhcG-yhcI	-49	6.8	AGTGTACTATTTACTTAATACACT	lin1836
Listeria monocytogenes EGD-e
Position: -49 Score: 7.0098 Sequence: AGTGTACTATTTAATTAATACACT Locus tag: lmo1725 Name: yhcF Funciton: Transcriptional regulator, GntR family Locus tag: lmo1724 Name: yhcG Funciton: ABC-type multidrug transport system, ATPase component Locus tag: lmo1723 Name: yhcI Funciton: ABC-type multidrug transport system, permease component
yhcF-yhcG-yhcI	-49	7	AGTGTACTATTTAATTAATACACT	lmo1725
Listeria seeligeri serovar 1/2b str. SLCC3954
Position: -47 Score: 6.82514 Sequence: AGTGTACTATTTACTTAATACACT Locus tag: lse_1696 Name: yhcF Funciton: Transcriptional regulator, GntR family Locus tag: lse_1695 Name: yhcG Funciton: ABC-type multidrug transport system, ATPase component Locus tag: lse_1694 Name: yhcI Funciton: ABC-type multidrug transport system, permease component
yhcF-yhcG-yhcI	-47	6.8	AGTGTACTATTTACTTAATACACT	lse_1696
Listeria welshimeri serovar 6b str. SLCC5334
Position: -50 Score: 6.82514 Sequence: AGTGTACTATTTACTTAATACACT Locus tag: lwe1742 Name: yhcF Funciton: Transcriptional regulator, GntR family Locus tag: lwe1741 Name: yhcG Funciton: ABC-type multidrug transport system, ATPase component Locus tag: lwe1740 Name: yhcI Funciton: ABC-type multidrug transport system, permease component
yhcF-yhcG-yhcI	-50	6.8	AGTGTACTATTTACTTAATACACT	lwe1742