Orthologous regulated operons containing Atu0777 gene

Properties
Regulog:	AfrR - Rhizobiales
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	1,5-Anhydro-d-Fructose utilization
Effector:
Phylum:	Proteobacteria/Alpha

Built upon 19 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Mesorhizobium loti MAFF303099
Position: -216 Score: 5.56413 Sequence: TAAATGGAACGTTCCAATAA Position: -52 Score: 5.65678 Sequence: GGATTAGAACGTTCCAATAG Locus tag: mlr3045 Name: afrR Funciton: Transcriptional regulator for 1,5-Anhydro-d-Fructose utilization, LacI family Locus tag: mlr3046 Name: afr Funciton: 1,5-anhydro-D-fructose reductase EC=1.1.1.292 Locus tag: mlr3047 Name: ydiF Funciton: putative CoA-transferase Locus tag: mlr3048 Name: crt Funciton: putative enoyl-CoA hydratase Locus tag: mlr3049 Name: aldh Funciton: putative aldehyde dehydrogenase Locus tag: mlr3050 Name: null Funciton: Sugar ABC transporter, substrate-binding protein Locus tag: mlr3052 Name: null Funciton: Sugar ABC transporter, inner membrane protein Locus tag: mlr3053 Name: null Funciton: Sugar ABC transporter, inner membrane protein Locus tag: mlr3054 Name: null Funciton: Sugar ABC transporter, ATP-binding protein Locus tag: mlr3056 Name: null Funciton: Glucose-methanol-choline (GMC) oxidoreductase:NAD binding site Locus tag: mlr3057 Name: fabG Funciton: putative oxidoreductase Locus tag: mlr3058 Name: null Funciton: Oxidoreductase, GMC family Locus tag: mlr3059 Name: null Funciton: hypothetical protein
afrR-afr-ydiF -crt-aldh-mlr3050-mlr3052-mlr3053-mlr3054-mlr3056-fabG-mlr3058-mlr3059	-216	5.6	TAAATGGAACGTTCCAATAA	mlr3045
	-52	5.7	GGATTAGAACGTTCCAATAG

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --