Orthologous regulated operons containing iolB gene

Built upon 13 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Jannaschia sp. CCS1
Position: -126 Score: 7.44503 Sequence: TTTTGCAACCGGTTGCAAAA Locus tag: Jann_1425 Name: iolK Funciton: Sugar ABC transporter, substrate-binding protein Locus tag: Jann_1426 Name: iolL Funciton: Sugar ABC transporter, inner membrane protein Locus tag: Jann_1427 Name: iolM Funciton: Sugar ABC transporter, ATP-binding protein Locus tag: Jann_1428 Name: null Funciton: Phytanoyl-CoA dioxygenase Locus tag: Jann_1429 Name: iolB Funciton: 5-deoxy-glucuronate isomerase (EC 5.3.1.-)
iolK-iolL-iolM-Jann_1428-iolB	-126	7.4	TTTTGCAACCGGTTGCAAAA	Jann_1425
Loktanella vestfoldensis SKA53
Position: -111 Score: 6.73742 Sequence: TTTTGCAACCGGTTGCAATT Locus tag: SKA53_08826 Name: iolK Funciton: Sugar ABC transporter, substrate-binding protein Locus tag: SKA53_08831 Name: iolL Funciton: Sugar ABC transporter, inner membrane protein Locus tag: SKA53_08836 Name: iolM Funciton: Sugar ABC transporter, ATP-binding protein Locus tag: SKA53_08841 Name: iolB Funciton: 5-deoxy-glucuronate isomerase (EC 5.3.1.-)
iolK-iolL-iolM-iolB	-111	6.7	TTTTGCAACCGGTTGCAATT	SKA53_08826

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --