Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing tal gene

Properties
Regulog: SgaR - Enterobacteriales
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Ascorbate utilization
Effector: Ascorbate-6-phosphate
Phylum: Proteobacteria/gamma
Built upon 34 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Erwinia carotovora subsp. atroseptica SCRI1043
Position: -91
Score: 5.33971
Sequence: ATCAGTTAGCGCTACCTTTT
Locus tag: ECA3773
Name: sgaA
Funciton: Ascorbate-specific PTS system, EIIA component (EC 2.7.1.-)
Locus tag: ECA3774
Name: sgaB
Funciton: Ascorbate-specific PTS system, EIIB component (EC 2.7.1.69)
Locus tag: ECA3775
Name: sgaT
Funciton: Ascorbate-specific PTS system, EIIC component
Locus tag: ECA3776
Name: tal
Funciton: Transaldolase (EC 2.2.1.2)
sgaA-sgaB-sgaT-tal -91 5.3 ATCAGTTAGCGCTACCTTTT ECA3773
© 2009-2020 RegPrecise