Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing RSc1792 gene

Properties
Regulog: RSc1790 - Ralstonia
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Sugar utilization
Effector:
Phylum: Proteobacteria/beta
Built upon 5 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Cupriavidus taiwanensis
Position: -74
Score: 6.58457
Sequence: GAATGAAAACGTTTTCATTT
Locus tag: RALTA_A1435
Name: RSc1790
Funciton: Predicted sugar utilization transcriptional regulator, LacI family
Locus tag: RALTA_A1434
Name: RSc1791
Funciton: Predicted sugar ABC transporter, substrate-binding protein
Locus tag: RALTA_A1433
Name: RSc1792
Funciton: Predicted sugar ABC transporter, permease protein 1
Locus tag: RALTA_A1432
Name: RSc1793
Funciton: Predicted sugar ABC transporter, permease protein 2
Locus tag: RALTA_A1431
Name: RSc1794
Funciton: Predicted sugar ABC transporter, ATP-binding protein
Locus tag: RALTA_A1430
Name: RSc1795
Funciton: 3',5'-cyclic-nucleotide phosphodiesterase (EC 3.1.4.17)
RSc1790-RSc1791-RSc1792-RSc1793-RSc1794-RSc1795 -74 6.6 GAATGAAAACGTTTTCATTT RALTA_A1435
Ralstonia eutropha H16
Position: -2
Score: 6.69266
Sequence: CAATGAAAACGTTTTCATCC
Locus tag: H16_B1599
Name: RSc1790
Funciton: Predicted sugar utilization transcriptional regulator, LacI family
Locus tag: H16_B1600
Name: RSc1791
Funciton: Predicted sugar ABC transporter, substrate-binding protein
Locus tag: H16_B1601
Name: RSc1792
Funciton: Predicted sugar ABC transporter, permease protein 1
Locus tag: H16_B1602
Name: RSc1793
Funciton: Predicted sugar ABC transporter, permease protein 2
Locus tag: H16_B1603
Name: RSc1794
Funciton: Predicted sugar ABC transporter, ATP-binding protein
Locus tag: H16_B1604
Name: RSc1795
Funciton: 3',5'-cyclic-nucleotide phosphodiesterase (EC 3.1.4.17)
RSc1790-RSc1791-RSc1792-RSc1793-RSc1794-RSc1795 -2 6.7 CAATGAAAACGTTTTCATCC H16_B1599
Ralstonia metallidurans CH34
Position: -52
Score: 6.69266
Sequence: CAATGAAAACGTTTTCATCG
Locus tag: Rmet_4839
Name: RSc1790
Funciton: Predicted sugar utilization transcriptional regulator, LacI family
Locus tag: Rmet_4840
Name: RSc1791
Funciton: Predicted sugar ABC transporter, substrate-binding protein
Locus tag: Rmet_4841
Name: RSc1792
Funciton: Predicted sugar ABC transporter, permease protein 1
Locus tag: Rmet_4842
Name: RSc1793
Funciton: Predicted sugar ABC transporter, permease protein 2
Locus tag: Rmet_4843
Name: RSc1794
Funciton: Predicted sugar ABC transporter, ATP-binding protein
Locus tag: Rmet_4844
Name: RSc1795
Funciton: 3',5'-cyclic-nucleotide phosphodiesterase (EC 3.1.4.17)
RSc1790-RSc1791-RSc1792-RSc1793-RSc1794-RSc1795 -52 6.7 CAATGAAAACGTTTTCATCG Rmet_4839
Ralstonia pickettii 12J
Position: -35
Score: 6.02252
Sequence: GCATGTAAACGTTTACACCT
Locus tag: Rpic_1419
Name: RSc1790
Funciton: Predicted sugar utilization transcriptional regulator, LacI family
Locus tag: Rpic_1418
Name: RSc1791
Funciton: Predicted sugar ABC transporter, substrate-binding protein
Locus tag: Rpic_1417
Name: RSc1792
Funciton: Predicted sugar ABC transporter, permease protein 1
Locus tag: Rpic_1416
Name: RSc1793
Funciton: Predicted sugar ABC transporter, permease protein 2
Locus tag: Rpic_1415
Name: RSc1794
Funciton: Predicted sugar ABC transporter, ATP-binding protein
Locus tag: Rpic_1414
Name: RSc1795
Funciton: 3',5'-cyclic-nucleotide phosphodiesterase (EC 3.1.4.17)
RSc1790-RSc1791-RSc1792-RSc1793-RSc1794-RSc1795 -35 6 GCATGTAAACGTTTACACCT Rpic_1419
Ralstonia solanacearum GMI1000
Position: -38
Score: 6.13062
Sequence: CGATGTAAACGTTTACAAGC
Locus tag: RS04189
Name: RSc1790
Funciton: Predicted sugar utilization transcriptional regulator, LacI family
Locus tag: RS04190
Name: RSc1791
Funciton: Predicted sugar ABC transporter, substrate-binding protein
Locus tag: RS04191
Name: RSc1792
Funciton: Predicted sugar ABC transporter, permease protein 1
Locus tag: RS04192
Name: RSc1793
Funciton: Predicted sugar ABC transporter, permease protein 2
Locus tag: RS04193
Name: RSc1794
Funciton: Predicted sugar ABC transporter, ATP-binding protein
Locus tag: RS04195
Name: RSc1795
Funciton: 3',5'-cyclic-nucleotide phosphodiesterase (EC 3.1.4.17)
RSc1790-RSc1791-RSc1792-RSc1793-RSc1794-RSc1795 -38 6.1 CGATGTAAACGTTTACAAGC RS04189